Murine iPSC exhibit a potent block to HIV-1-based vectors

In this study we analyzed the susceptibility of murine iPSC for vectors derived from HIV-1 (LV; lentiviral vectors) or from Moloney MLV (GV; gammaretroviral vectors). Both retroviral vectors were designed with self-inactivating (SIN) architecture and expressed the enhanced green fluorescence protein (EGFP) reporter gene driven by a short version of the human elongation factor 1 alpha gene (EFS) promoter (Fig. 1a). If not indicated otherwise, we generated vector particles pseudotyped with the vesicular stomatitis virus glycoprotein (VSVg) envelope containing the vector RNA and the retroviral wt replication enzymes and structural proteins. Prior to iPSC transduction, vector supernatants were always titrated on permissive HT1080eCat cells in order to utilize comparable vector doses for following experiments. To compare retroviral transgene transfer into iPSC, LV and GV were applied to iPSC at defined multiplicities of infection (MOI). All iPSC used in this study were generated by ectopic expression of the octamer-binding transcription factor 4 (Oct4), sex determining region Y-box 2 gene (Sox2), Kruppel-like factor 4 (Klf4) and c-Myc in primary fibroblasts (Fig. 1b). A previously characterized and described iPSC clone (clone #2EX) was used throughout this study [15]. In this clone, the reprogramming cassette was excised by Flp recombinase to prevent interference with the integrated lentiviral reprogramming vector during PCR-based analyses. Transduced cells were analyzed for EGFP and anti-stage specific antigen marker 1 (SSEA1) (pluripotency marker in murine cells) co-expression by flow cytometry. Major differences in the susceptibility of murine iPSC for the tested retroviral vectors were observed. Notably, both GV and LV exhibited low transduction rates in iPSC using MOI 10 and 100 (Fig. 1c, left graph). However, LV transduction efficiency remained significantly reduced compared to GV at both MOI. Analyses of the mean vector copy number per cell (detecting EGFP) revealed significantly less integrated vector copies in LV transduced iPSC indicating a pre-integration block (Fig. 1c, right graph). To exclude iPSC clone-specific abnormalities as the basis for the poor permissiveness to LV, we compared clone #2EX (excised reprogramming cassette) to a variety of iPSC clones generated by different reprogramming approaches and derived from various mouse strains. Additionally, we incorporated clones with non-excised reprogramming cassettes, including the parental clone #2 for direct comparison to the #2EX excised version. Remarkably, all tested iPSC clones demonstrated significantly less susceptibility to LV transduction, suggesting that LV restriction is independent from the genetic background and the presence of the reprogramming cassette (Fig. 1d). To analyze whether naturally occurring PSC are susceptible to LV, we tested murine ESC. As similarly observed in iPSC, we measured decreased transduction rates for LV, in contrast to GV, caused by reduced integration events (Fig. 1e).

LV restriction is observed exclusively in the pluripotent state of a cell

Next, we asked, if inhibition of LV gene transfer appears only in iPSC or can also be observed in the parental cells used for reprogramming or in iPSC differentiated progeny. In contrast to iPSC, the parental fibroblasts used for reprogramming, did not show a LV restriction (Fig. 2a). To further test, whether LV restriction is directly correlated with the pluripotent state of the cells, we investigated if the differentiated progeny of iPSC regained permissiveness to LV. We differentiated iPSC by withdrawal of the leukemia inhibitory factor (LIF) and cultured the cells in the absence of supporting feeder cells (Fig. 2b, upper panel). Differentiated cultures were transduced with LV or GV encoding DsRedExpress (LV.DsRed and GV.DsRed). Transduced cells were stained with a green fluorescent SSEA1 antibody and live cell imaging was accomplished by fluorescence microscopy. Almost exclusively SSEA1 negative cells were transduced with LV, whereas SSEA1 and DsRedExpress double positive cells were observed more frequently after transduction with GV (Fig. 2b, lower panel). To better quantify transduction rates, we analyzed differentiated (SSEA1−) or remaining pluripotent (SSEA1+) cells by flow cytometry. In line with the fluorescence microscopy approach, only a small amount of SSEA1+ cells were susceptible to LV in contrast to differentiated SSEA1− cells (4.6 ± 1.6% vs. 19.8 ± 4.9%), while permissiveness of SSEA1+ and SSEA1− cells for GV particles was comparable (26 ± 13.7% vs. 33.5 ± 8.4%) (Fig. 2c). The impact of cell pluripotency on the LV block was further tested using embryonic carcinoma cells (ECC) as an additional pluripotent-like cell model [16]. Interestingly, ECC showed no LV restriction as observed in iPSC or ESC (Fig. 2d).

LV transduction rate in murine iPSC is enhanced by high vector doses and CSA treatment

It was previously shown that permissiveness of specific cell types to HIV-1 can be enhanced by altering the viral entry route [17, 18]. Therefore, we performed a side-by-side comparison of envelope pseudotypes used for LV particle generation. We tested VSVg-pseudotyped LV (LV-VSVg) and included particles pseudotyped with glycoproteins derived from amphotropic (LV-Ampho) or ecotropic MLV (LV-Eco). While LV-VSVg enters cells via clathrin-mediated endocytosis [19], LV-Ampho employs cell membrane fusion and/or macropinocytosis [20, 21], and LV-Eco enters cells by calveolae-dependent endocytosis and/or direct cell membrane fusion [22–24]. Although LV-VSVg, LV-Ampho and LV-Eco particles obtained comparable titers on permissive HT1080eCat cells (Fig. 3a, left graph), all vectors showed very low transduction rates of iPSC (less than 1%) at an MOI of 10 (Fig. 3a, right graph). Previous work demonstrated the possibility to apply high virus doses to overcome a restriction factor-mediated block [25–28]. Thus, we transduced murine iPSC with LV at increasing MOI. Transduction rates were enhanced from 0.84 ± 0.45% (MOI 10) to 25.83 ± 2.57% (MOI 2000) (Fig. 3b). Despite a 30-fold increase with the highest vector dose, the majority of iPSC remained untransduced, suggesting relatively inefficient abrogation of LV restriction. Next, we performed pre-transduction (Pre-Td) experiments followed by a second transduction to investigate a potential increase in transducability in a second round of transduction. This method is frequently used to provide evidence for a saturable restriction factor, when the factor can be abrogated at a certain MOI of the restricted incoming viral particles [28, 29]. Pre-Td was conducted with DsRedExpress encoding LV.DsRed and GV.DsRed at an MOI of 1000. GV.DsRed Pre-Td served as a control to exclude common cellular defense mechanisms after transduction with high MOI. Following published protocols, a second transduction was then performed with EGFP-encoding LV, at an MOI of 100, 6 h after Pre-Td [25, 28]. Although having conducted successful Pre-Td (Fig. 3c, right graph), Pre-Td resulted in no beneficial effect on LV transduction rates (Fig. 3c, left graph). Next, we tested the small molecules MG132 and cyclosporine A (CSA), which were previously described to enhance lentiviral transduction and counteract lentiviral restriction [11, 30–33]. Dose escalation experiments (using 0.05–0.4 µM) with the proteasome inhibitor MG132 failed to increase LV transduction rates in iPSC (Fig. 3d). Of note, at doses ≥ 0.2 µM, we observed a cytotoxic effect of the drug, resulting in decreased cell numbers as well as in increased AnnexinV and PI positive cells (see Additional file 1). To investigate if abrogation of the CypA-capsid interaction by CSA treatment could circumvent the restriction, as this has been described in other cell types in previous studies [34–37], we transduced iPSC in the presence or absence of different CSA doses. Strikingly, CSA treatment during transduction significantly enhanced LV transduction rates in a dose-dependent manner (Fig. 3e, left graph). In contrast, CSA had no statistically significant effect on GV transduction rates (Fig. 3e, right graph). Of note, while no apoptosis or cell death was observed for any tested CSA concentration, decreased cell numbers were observed with 20 µM CSA (see Additional file 2). Since doses ≤ 10 µM did not affect cell numbers, a concentration of 10 µM CSA was chosen for all further experiments.

CypA-capsid interaction mediates LV restriction in iPSC

To characterize the dependency of CSA on the time of its addition, we conducted a kinetic study and treated iPSC with CSA at different time points prior to and during transduction. LV transduction without CSA treatment contained equal amounts of DMSO as a solvent control. Interestingly, the strongest CSA effect on LV transduction rate enhancement in iPSC was achieved when adding CSA before (−0.5 h) or at the time of transduction (0 h) (Fig. 4a). Nevertheless, CSA addition still had a significant effect on iPSC susceptibility to LV even when applied 12 h after retroviral vector application. To test whether CypA-capsid interaction mediates the LV restriction or if CSA acts through different mechanisms, we prevented CypA binding to the HIV-1 capsid by using specific CypA-independent HIV-1 capsid mutants. We compared HIV-1 wt capsid and the mutant capsid variants G89V, P90A, H2.1 and A88T for their ability to transduce iPSC. The G89V, P90A and A88T capsid mutants harbor a point mutation causing a single amino-acid change in the CypA binding loop of the HIV-1 capsid, preventing CypA binding to the capsid [36, 38]. Of note, the A88T mutant was shown to prevent binding of CypA and also the myxovirus resistance 2 (Mx2) protein, which was identified as an HIV-1 restriction factor [34–36]. The H2.1 mutant contains a substitution of the equivalent CypA binding loop sequences of HIV-1 to HIV-2, which does not bind CypA [39]. Remarkably, all CypA-independent capsid mutants exhibited clearly improved LV transduction rates (Fig. 4b). In addition, we tested the capsid mutant N74D. N74D harbors a point mutation, which prevents binding of cleavage and polyadenylation specific factor 6 (CPSF6) to the capsid, binds CypA to a lower extent than wt capsids and favors a different nuclear entry route compared to the wt capsid [8, 40, 41]. It was previously reported that the early steps of infection by the N74D capsid mutant virus were inhibited prior to RT in macrophages [42]. Importantly, we did not observe this effect in iPSC, since late RT products using N74D mutant and wt capsid were comparable (see Additional file 3). Interestingly, the N74D capsid mutant did not improve LV transduction (Fig. 4b). To investigate whether the differences in LV transduction efficiencies observed between iPSC and differentiated cell types were due to different intrinsic CypA protein levels, Western blot analyses were used to compare CypA levels in iPSC with their parental fibroblasts and other primary fibroblasts. iPSC displayed comparable CypA levels to the permissive Mefs, indicating that LV restriction was not due to altered CypA protein expression (Fig. 4c).

Low efficiency of LV transduction in iPSC is associated with reduced levels of 2-LTR circles and proviral DNA integration

We observed strongly reduced vector copies in LV transduced iPSC (Fig. 1c). To characterize the observed LV restriction in greater detail and to identify the step of the early retroviral life cycle affected in iPSC, we analyzed the generation of viral intermediates between cellular entry and integration. iPSC were transduced with LV at an MOI of 10 and emerging RT products were analyzed with TaqMan-based quantitative real-time PCR at different time points. CSA treated cells served as a control for effective LV transduction. RT product levels were normalized to endogenous polypyrimidine tract binding protein 2 (PTBP2) DNA copies. Heat-inactivated supernatants (plasmid ctrl) served as a control for plasmid contamination in the viral vector preparations and DMSO as the solvent control for CSA treated cells. No differences were detected in early RT (Fig. 5a) or late RT product levels (Fig. 5b) when comparing DMSO to CSA treated iPSC. To analyze whether the reverse transcribed viral DNA is imported into the nucleus, we investigated the levels of 2-LTR circles, which are considered as a marker for nuclear entry and are formed in the nucleus by the host cell repair machinery [43–45]. The levels of 2-LTR circles were analyzed by TaqMan-based quantitative real-time PCR (normalized to PTBP2). Primers and probes were designed to detect the LTR-LTR junction region to avoid detection of LV autointegration [45]. In DMSO treated samples, 2-LTR circles were significantly reduced at 6 and 12 h after vector application when compared to CSA-treated cells (Fig. 5c). Next, we included the integrase inhibitor Raltegravir to impede integration and to determine the amount of 2-LTR circles in the presence or absence of CSA. The inhibition of integration by Raltegravir led to significantly higher levels of 2-LTR circles in CSA treated cells, but only a minor increase of 2-LTR circles in DMSO treated cells (see Additional file 4A). Interestingly, treatment of transduced iPSC with Raltegravir and CSA compared to Raltegravir alone led to significantly elevated 2-LTR circle levels. These findings further strengthen the hypothesis that nuclear entry of LV was impaired in iPSC. Strikingly, CSA treatment also significantly increased integrated vector copy numbers (see Additional file 4B). Transduction of Mefs treated under identical conditions served as permissive controls and showed no major effect of CSA on transduction rates in these cells (see Additional files 4A and B). To determine the time point of integration, we analyzed samples from Fig. 5a–c with the B1-LTR PCR, which is the mouse equivalent to the human Alu-LTR PCR. Briefly, proviral integrants were detected with primers detecting the LTR and the B1 repetitive elements in the genome (first stage of PCR), followed by a nested LTR amplification step (second stage PCR). Proviral integration started at 12 h and reached a plateau 24 h after vector application, with no major differences thereafter (as measured at 48 h and a late 6 day time point) (Fig. 5d).

Retroviral vector plasmids

Lentiviral vector plasmids pRRL.PPT.EFS.EGFP.pre [50–52] and pRRL.PPT.SFFV.DsRedExpress.pre [53] were referred to as LV and LV.DsRed, respectively. Gammaretroviral vectors pSERS11.EFS.EGFP.pre [52] and pSF91.DsRedExpress [53] were termed GV and GV.DsRed. Except for the LTR-driven GV.DsRed, all vectors had SIN designs with deletions of the viral U3 regions (∆U3), instead containing the internal EFS promoter (short version/250 bp fragment of promoter/enhancer sequences from the human elongation factor 1 alpha gene) or, for LV.DsRed, the SFFV promoter (promoter/enhancer sequences from spleen focus forming virus). For reprogramming, the lentiviral “4-in-1” construct pRRL.PPT.SF.hOKSMco.id.Tom.pre.F+F3, co-expressing codon-optimized versions of the transcription factors Oct4, Klf4, Sox2 and wt c-Myc, was used [15, 54]. The construct contained heterospecific FRT sites (F and F3) to allow Flp recombinase-mediated excision of the reprogramming cassette [15, 55].

Cells and cultivation

Human 293T (embryonic kidney cell line) [56], human HT1080eCat (fibroblast cell line HT1080 [57] expressing the murine ecotropic receptor mCAT-1 [53]) and the murine ECC line F9 (kindly provided by S. P. Goff, Columbia University Medical Center, New York, NY, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Biochrom GmbH, Berlin, Germany) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (GE Healthcare Europe GmbH, Freiburg, Germany), 100 U/mL penicillin, 100 µg/mL streptomycin and 1 mM sodium pyruvate (all from PAN-Biotech, Aidenbach, Germany). CF-1 Mefs (MTI Global Stem, Gaithersburg, MD, USA) and C3H Mefs (kindly provided by T. Cantz, Hannover Medical School, Hannover, Germany) as well as freshly isolated murine adult fibroblasts (C57BL/6 p14f/f) were grown in low glucose DMEM (PAN-Biotech) supplemented with 15% heat-inactivated FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, 2 mM l-glutamine, 1% MEM non-essential amino acids solution (Gibco Life Technologies GmbH, Darmstadt, Germany) and 100 µM beta-mercaptoethanol (Sigma-Aldrich, Munich, Germany) on gelatin pre-coated (0.1% gelatin in phosphate buffered saline (PBS)) wells or flasks. PSC were co-cultured with irradiated (30 Gy) C3H Mefs in ESC medium composed of Knockout DMEM (Gibco Life Technologies) with 15% ESC-tested and heat-inactivated FBS (GE Healthcare Europe GmbH), 2 mM l-glutamine, 100 U/mL penicillin, 100 µg/mL streptomycin, 1% MEM non-essential amino acids, 100 µM beta-mercaptoethanol and 10³ U/mL LIF (kindly provided by the Department of Technical Chemistry, Leibniz University Hannover, Hannover, Germany). The following murine PSC were used in this study: iPSC clone #1 (C57BL/6 mouse strain), clones #2, #2EX (excised reprogramming cassette) and #3 (C57BL/6 p14f/f, wt version without conditional knockout of the p14 gene, reprogrammed from adult fibroblasts, mice kindly provided by D. Kotlarz and C. Klein, Ludwig Maximilian University, Munich, Germany), clone #4 (reprogrammed from C3H Mefs) and ESC (C57BL/6 mouse strain, kindly provided by I. Prinz, Hannover Medical School).

Retroviral particle production

One day before transfection, 5 × 10⁶ 293T cells were seeded per 10-cm dish. Transfection was performed based on the calcium phosphate precipitation method assisted by 25 µM chloroquine (Sigma-Aldrich). For LV or LV.DsRed, packaging cells were co-transfected with 5 μg LV plasmid, 5 μg pRSV-Rev (kindly provided by T. Hope, Northwestern University, Chicago, IL, USA), 1.5 μg pMD.G (VSVg) [58], 12 μg wt pcDNA3.gp.4xCTE (HIV-1 Gag-Pol) [59] or CypA-independent capsid mutant Gag-Pol P90A, G89V, A88T or H2.1 or the N74D mutant [36, 38, 39, 41]. Mutations were introduced by overlap extension PCR and confirmed by sequencing. For production of LV-Ampho(tropic) and LV-Eco(tropic) particles, 2 μg ecotropic [60] or 2 μg amphotropic [61] MLV envelope encoding plasmids were used. To package VSVg pseudotyped GV or GV.DsRed particles, 5 μg GV plasmid, 7 μg pcDNA3.MLV.GP (MLV Gag-Pol) [59] and 1.5 μg pMD.G were co-transfected. Supernatants were harvested 36 and 48 h after transfection, filtered through 0.22 μm pore-size-filters and concentrated (100×) by ultracentrifugation (2 h, 82,740×g, 4 °C) (SW32Ti rotor; Beckman Coulter GmbH, Krefeld, Germany). Viral pellets were resuspended in ESC medium and stored in aliquots at −80 °C until further usage.

Retroviral particle titration and transduction

One day before titration of vector supernatants, 7 × 10⁴ HT1080eCat cells were seeded per well of a 12-well plate. The next day, the culture medium was removed and serial dilutions of vector supernatants were added to the cells. Viral transduction of cells was performed in the presence of 4 µg/mL protamine sulfate and spin-inoculation (1 h, 863×g, 37 °C). Three days after transduction, the percentage of fluorescent cells was analyzed by flow cytometry. Vector particle titers were calculated only including samples with < 30% transduced cells to avoid multiple proviral integration events per cell and false titer estimation. Mefs (3 × 10⁴ cells per well of a 12-well plate) or ECC (5 × 10⁴ cells per well of a 12-well plate) were seeded the day before transduction. Specific amounts of vector particles per cell, referred to as MOI, were applied and cells were treated as described above for titration. PSC were transduced in single cell suspension and separated with 0.5% Trypsin-EDTA in PBS (Gibco Life Technologies GmbH) on the day of transduction. Afterwards, PSC were centrifuged (138×g, 5 min) and depleted from feeder cells. Depletion was performed by incubating the cells on a 15-cm plate (40 min, 37 °C, 5% CO₂) to separate the faster attaching feeder from PSC. After applying vector supernatants at specific MOI to 3 × 10⁴ cells (12-well plate) and adding 4 µg/mL protamine sulfate, a spin-inoculation step (1 h, 863×g, 37 °C) and an incubation step (1 h, 37 °C, 5% CO₂) were performed, before PSC were added to feeder cells. The next day, PSC had attached to the feeder cell layer, and the virus-containing medium was replaced by fresh ESC medium. For small molecule supplemented transductions, cells were incubated 30 min prior to and during transduction with indicated concentrations of CSA (Sigma - Aldrich), MG132 (Calbiochem/Merck Millipore, Darmstadt, Germany), Nevirapine (Sigma-Aldrich) or Raltegravir (Santa Cruz Biotechnology, Dallas, TX, USA). Depending on the cell type and experiment, cells were processed by flow cytometry 2 days (differentiated cultures), 3 days (HT1080eCat titration, C3H Mefs), 5–8 days (adult fibroblasts, ESC, ECC, iPSC) or at indicated time points after transduction.

Reprogramming murine primary fibroblasts to iPSC

Murine fibroblasts from the indicated mouse strains were reprogrammed and characterized as previously described by our group [15, 54].

Differentiation of iPSC

To induce differentiation, iPSC were depleted from feeder cells, seeded in gelatin pre-coated (0.1% gelatin in PBS) 12-well plates (5 × 10⁴ per well) and cultured in ESC medium without LIF and feeder cells. Medium was exchanged daily and cells were split in the range of 1:5–1:20 on days 3–4 and 5–6. Prior to transduction of differentiated cultures, cells were stained for SSEA1 expression and analyzed by flow cytometry to investigate their stem cell status. Differentiated cultures were transduced with retroviral particles (MOI 100) encoding EGFP or DsRedExpress 6–9 days after starting differentiation. Cells transduced with DsRedExpress encoding vectors were additionally stained with Stain Alive SSEA1 Antibody DyLight 488 according to the manufacturer’s protocol (Stemgent, Cambridge, MA, USA) and analyzed by fluorescence microscopy 2 days after transduction. Pictures were acquired with Axio Observer Z1 (Carl Zeiss AG, Jena, Germany) using Zeiss filter sets 43 (DsRedExpress) and 38 (DyLight 488) and AxioVision 4.8 software. Cells transduced with EGFP encoding vectors were analyzed by flow cytometry 2 days after transduction.

Flow cytometry

Cells were harvested and subsequently analyzed by flow cytometry (FACS Calibur, Becton-Dickinson, Heidelberg, Germany) using FlowJo software (Tree Star Inc, Ashland, OR, USA). In addition, PSC or differentiated cultures were stained with an Alexa 647 labeled SSEA1 antibody (1.5 ng per sample, 30 min, 4 °C) (eBioscience, San Diego, CA, USA). Samples were pre-gated for viable cells. Data from total viable cell populations with at least 50% SSEA1 positive cells were included in the analyses. The range of SSEA1 positive cells constituted mostly 70–100% throughout the study. The 70–100% range derives from differences between independent transduction experiments, but there were equivalent amounts of SSEA1 positive cells within each experiment. Cells, double positive for SSEA1 and EGFP, are shown in the graphs.

SYBR Green-based quantitative real-time PCR for detection of mean vector copy number per cell

iPSC were transduced with LV and GV and DNA was isolated 6–8 days after transduction. Vector copies per cell shown in Fig. 1c, e and Additional file 4B were determined by SYBR Green-based quantitative real-time PCR based on EGFP copies (Applied Biosystems, Darmstadt, Germany) using the QuantiTect SYBR-Green PCR Kit (Qiagen, Hilden, Germany) normalized to endogenous PTBP2 (EGFP for: 5′CTATATCATGGCCGACAAGCAGA3′, rev: 5′GGACTGGGTGCTCAGGTAGTGG3′; PTBP2 for: 5′GTCTCCATTCCCTATGTTCATGC3′, rev: 5′GTTCCCGCAGAATGGTGAGGTG3′). Master Mix preparation and PCR were performed as instructed by the manufacturer. Quantification of the mean vector copy number per cell were determined based on the comparative 2^−∆∆Ct method and based on a reference plasmid containing EGFP and PTBP2 sequences [62–64].

Analysis of RT products, 2-LTR circles and proviral integration by TaqMan-based quantitative real-time PCR

Vector supernatants were applied (MOI 10) to iPSC and CF-1 Mefs and remaining vector particles were removed by washing the cells twice with PBS 6 h after transduction. Cells were harvested at indicated time points. To test for plasmid contamination of vector supernatants, equivalent volumes of vector supernatants were heat-inactivated at 65 °C for 1 h and included in the analyses (plasmid ctrl). DNA isolation was performed with the QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s instructions. For TaqMan-based quantitative real-time PCR (Applied Biosystems), RT products were analyzed for early RT products (strong-stop DNA, for: 5′GCCTCAATAAAGCTTGCCTTGA3′, rev: 5′TGACTAAAAGGGTCTGAGGGATCT3′, probe: 5′AGAGTCACACAACAGACGGGCACACACTA3′), late RT products (U5/downstream PBS, for: 5′TAGTGTGTGCCCGTCTGTTG3′, rev: 5′GAGTCCTGCGTCGAGAGAG3′, probe: 5′TCCCTCAGACCCTTTTAGTCA3′) and 2-LTR circles (junction, for: 5′TAGTGTGTGCCCGTCTGTTG3′, rev: 5′CAGAGAGACCCAGTACAAGC3′, probe: 5′CTCTAGCAGTAACTGGAAGGGCT3′). PTBP2 served as a housekeeping control (for: 5′TCTCCATTCCCTATGTTCATGC3′, rev: 5′GTTCCCGCAGAATGGTGAGGTG3′, probe: 5′ATGTTCCTCGGACCAACTTG3′). RT products were relatively quantified using the comparative 2^−∆∆Ct method [62, 63]. PCR was performed at 50 °C for 2 min and at 95 °C for 20 s followed by 60 cycles of 5 s at 95 °C, 20 s at 56 °C and 20 s at 65 °C.

B1-LTR PCR for analysis of proviral integration

Briefly, a first stage PCR was run with a LTR forward primer, which was designed to harbor a lambda-phage heel sequence at the 5′ end and LTR sequences at the 3′ end. In addition, two outward facing primers binding the highly redundant consensus sequence within the mouse B1 repetitive element were used in the first stage PCR. This was followed by a second stage TaqMan-based quantitative real-time PCR, which amplified the LTR using a lambda-specific forward and an LTR-specific reverse primer, scored using an LTR-specific probe. Primer sequences and protocol were used from Tervo et al. [65]. For data analyses, genomic DNA from a SC-1 standard cell line, harboring three HIV-1-based vector integrations [66], was diluted over a range of concentrations covering three logs. Slope and y-intercept of the standard curve were used to determine proviral copies. PTBP2 served as a housekeeping control. To exclude plasmid contamination of vector supernatants, 5 µM Nevirapine was used as an RT inhibitor, for every time point with equivalent volumes of vector supernatants, and signals were subtracted from the total signal. For each sample, PCR controls, omitting the B1 forward and reverse primers or the Lambda-LTR forward primer, were performed in parallel during the first PCR stage. The approach omitting the Lambda-LTR forward primer did not reveal any signal. The signal achieved by omission of B1 forward and reverse primers was subtracted from the total signal for each sample.

Western blot analysis

Cells were harvested, washed with PBS and lysed by using radioimmunoprecipitation assay buffer supplemented with proteinase inhibitors (Complete Mini, Roche, Mannheim, Germany). Samples (15 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12.5%) and blotted onto nitrocellulose membranes (GE Healthcare Europe GmbH). Antibody probing was conducted with rabbit monoclonal anti-CypA (Cell Signaling Technology, Danvers, MA, USA) and rabbit polyclonal Erk2 (Santa Cruz Biotechnology) according to the manufacturer’s instructions. Goat anti-rabbit IgG conjugated with horseradish peroxidase was used as a secondary antibody. Quantitative detection was carried out using the Fusion Fx system (Peqlab GmbH/VWR Life Science Competence Center, Erlangen, Germany).

Pre-transduction/abrogation experiments

iPSC were pre-transduced with LV.DsRed or GV.DsRed at an MOI of 1000. After spin-inoculation cells were incubated at 37 °C and 5% CO₂. After 6 h incubation time, iPSC were washed twice with PBS and a second transduction with LV was performed. LV encoding EGFP at an MOI of 100 were used for the second transduction. Flow cytometry analyses were conducted 4 days after transduction experiments.

Statistical analysis

Data were expressed as mean ± standard deviation. Where appropriate, we used one-way ANOVA with Tukey-Kramer post hoc test to adjust for multiplicity effects. When comparing all groups to one control group, we utilized one-way ANOVA with Dunnett post hoc test. For time course analyses, we utilized repeated measures one-way ANOVA with appropriate post hoc test. The unpaired t test was performed for comparison of two groups. In case of significantly different variances between the groups, the unpaired t test with Welch’s correction was applied. p values of ≤ 0.05 were considered significant (*), ≤  0.01 very significant (**), ≤  0.001 extremely significant (***), and ns was considered not significant. Supplementary material and methods are described in Additional file 6.