Cells, HIV-1 and constructs
Buffy coats were obtained from the Blood Transfusion Service, Massachusetts General Hospital, Boston, MA, in compliance with the Beth Israel Deaconess Medical Center Committee on Clinical Investigations (CCI) protocol #2008-P-000418/5. Buffy coats were provided at this institution for research purposes; therefore, no informed consent was further needed. In addition, buffy coats were provided without identifiers. This study was approved by Beth Israel Deaconess Medical Center’s CCI, Institutional Review Board, and Privacy Board appointed to review research involving human subjects. The experimental procedures were carried out in strict accordance with approved guidelines.
Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coat by centrifugation, using a Ficoll-Paque density gradient (GE Healthcare Biosciences, Piscataway, NJ) and CD14+ monocytes were isolated using a positive selection kit per manufacturer’s protocol (STEMCELL Technologies, Inc., Vancouver, BC). Monocyte derived dendritic cells (hereafter referred as DCs) were prepared and cultured as previously described [21]. Monocyte-derived macrophages (hereafter referred as macrophages) were generated by culturing monocytes in RPMI supplemented with 10% FCS, 2 mM L-glutamine, 100 IU/ml penicillin, 100 μg/ml streptomycin, 1% nonessential amino acids, 1 mM sodium pyruvate, 500 IU/ml M-CSF (PeproTech Inc., Rocky Hill, NJ). Autologous T-cells from human peripheral blood mononuclear cells, were prepared and cultured as previously described [41]. Human Brain Microvascular Endothelial Cells (HBMEC) were kindly donated by Dr. Marsha Moses, Harvard Medical School, Boston, and cultured in Endothelial Basal Medium with growth supplements (Lonza, Alpharetta, GA) as per manufacturer’s instructions. HIV-1 infected U937 cells (U1) cells were obtained from NIH (Germantown, MD) and cultured in RPMI supplemented with 2 mM L-glutamine and 10% heat-inactivated FBS, as per instructions. HIV-1 replication was induced in U1 cells by treatment with 10 nM of Phorbol 12-myristate 13-acetate (PMA) (MilliporeSigma, Burlington, MA)
HIV-1 BaL was obtained from the NIH AIDS Research and Reference Reagent Program, National Institute of Allergy and Infectious Diseases, NIH. HIV-1 stocks were prepared as previously described [41].
Antibodies and reagents
BST-2, CD63, CD9, CD81, TSG101, LSP-1, LAMP-1, GW182, HIV-1 Reverse Transcriptase, HIV-1 p24, Actin and GAPDH antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Integrin β1, Ago2, TRBP-2 and Dicer antibodies were obtained from Cell Signaling Technology (Danvers, MA). MHC II antibody were obtained from Abcam (Cambridge, MA). LFA-1 antibody was obtained from R&D systems (Minneapolis, MN). Exosome-depleted FBS was obtained from System Biosciences (Palo Alto, CA).
EV isolation
For exosome preparations, T-cells, DCs and macrophages (2 × 106 cells/ml) were infected with HIV-1 BaL (10 ng/ml of HIV-1 p24) after 2 hours of pretreatment with/without cocaine (10 µM) in an exosome depleted medium. After 3 days, we quantitated the p24 titer in cell supernatants of all cells. EVs were isolated from cell supernatants by a combination of centrifugation and filtration: 700×g to remove cells and debris, filtering the supernatants on 0.45 µm pore filters, followed by ultracentrifugation at 100,000×g (Beckman L8-70M, Type 90 Ti Fixed-angle Titanium rotor and washing with 0.2 µm filtered 1X PBS by ultracentrifugation at 100,000×g. Next, CD63+ EVs were purified using Exo-Flow™ Exosome Purification kits (System biosciences, Mountain View, CA) or Exosome-Human CD63 Isolation/Detection Reagent from Invitrogen (Carlsbad, CA) as per manufacturer’s protocol. In each EV preparation, the concentration of total proteins was quantified by Bradford assay (Bio-Rad Laboratories, Hercules, CA). EVs were quantified by using Nano-flow cytometry and NanoSight. For experiments with RNA, pellets were lysed with RNA lysis buffer to isolate RNA. For experiments with EV lysates, pellets were lysed with 1x cell lysis buffer.
Western blotting and immunoprecipitation
Western blotting was performed as previously described [21]. Briefly, EV pellets or whole cell pellets of uninfected and HIV-1 infected T-cells, DCs or macrophages were collected in cell lysis buffer, protein lysates were separated on NuPAGE precast gels (Life Technologies Corp.), transferred to 0.45 μm nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA), and probed with appropriate primary antibodies followed by incubation with their respective secondary antibodies (LI-COR, Lincoln, NE) and imaged using LI-COR Odyssey CLX (LI-COR). Membranes were stripped by using Re-Blot Plus (MilliporeSigma, Burlington, MA), and re-probed by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or Actin as a loading control. Analysis and relative quantification of gel bands was carried out using ImageJ software (NIH, Bethesda, MD).
Immunoprecipitation assay was performed as previously described [21]. Equivalent amounts of protein extract were run on a 4% to 12% gradient acrylamide gel (NuPAGE Bis-Tris gel; Invitrogen, Carlsbad, CA) and transferred onto nitrocellulose membranes. Immunodetection involved specific primary antibodies, appropriate secondary antibodies conjugated to horseradish peroxidase, and a chemiluminescent Western blotting detection system (LI-COR).
EV trans-infection in T-cells
T-cells (1 × 106/ml) were infected either with 1 µg of total protein of CD63+ EVs derived from untreated or cocaine treated and HIV-1 infected macrophages and DCs for 7 days at 37°C. Supernatants were harvested on days 1, 3 and 7, and p24 concentrations were quantified by ELISA.
Quantitative RT-PCR
RNA was isolated from EVs derived from cocaine treated or untreated HIV-1 infected T-cells, DCs and macrophages by Quick-RNA MiniPrep isolation kit according to the manufacturer’s instructions (Zymo Research, Irvine, CA). DNase treatment was performed using TURBO DNA-free kit (Ambion RNA, Carlsbad, CA). EV RNA (0.4 µg) was used to prepare cDNA using iSCRIPT cDNA synthesis kit (Bio-Rad, Hercules, CA). qRT-PCR was done in triplicates for each sample with SYBR green based SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Hercules, CA) using 50 ng cDNA. Gene expression was normalized to TATA-box binding protein (TBP) and relative expression was calculated using 2−ΔCt method. Specificity of the primer sets was confirmed by melting curve analysis.
GAG_F: TTGGTCCAAAATGCGAACCC, GAG_R: ACTTGGCTCATTGCTTCAGC
RRE_F: TGGGCAAGTTTGTGGAATTGG, RRE_R: ACCTACCAAGCCTCCTACTATC
Electron microscopy
DCs (1 × 106) were cultured on Aclar (resin) coverslips. Cells were untreated or treated with cocaine (10 μM), infected or uninfected with HIV-1 (10 ng/ml) for 72 h. Cells fixed with 8% PFA 1:1 for 2 minutes followed by fixing in 4% PFA for 1 hour at 37 °C and replacing PFA with 1X PBS prior to immune-labelling. Subsequent processing and immunogold staining with anti-human BST-2 antibodies was done by Harvard Medical School Electron Microscopy Core.
Confocal microscopy
Macrophages were cultured on chamber slides. They were untreated or treated with cocaine (10 μM), infected or uninfected with HIV-1 (10 ng/ml) for 72 h. They were fixed in 4% paraformaldehyde and blocked with 5% normal goat serum in PBS/Triton X100 (1 h). Cells were then incubated with primary antibodies overnight at 4 °C, washed thrice with PBS, and stained with AlexaFluor 546–labeled anti–mouse IgG antibody or AlexaFluor 488–labeled anti–rabbit IgG antibody (Molecular Probes®; Invitrogen) for 2 hours. Subsequently, cells were washed thrice with PBS, and slides were mounted using Prolong Gold antifade with DAPI (4′,6-diamidino-2-phenylindole; Invitrogen). Slides were examined under a Zeiss 880 Meta confocal microscope (Carl Zeiss Microimaging, LLC, Thornwood, NY), and images were acquired using ZEN2 software (Carl Zeiss).
EV uptake assay
HBMECs were seeded into 8-well chamber slides at a density of 104 cells per well and incubated in 5% CO2 incubator at 37°C for 24 hours to form a uniform monolayer of cells. The cells were treated with or without cocaine. After 30 minutes, the cells were treated with equal number of PKH26 labelled EVs derived from HIV-1 infected macrophages and DCs and incubated in 5% CO2 incubator at 37°C for 2 hours. Cells were washed for removal of unbound EVs and fixed with Formalin. The chamber slides were imaged using a wide-field fluorescence microscope (Carl Zeiss Microscopy LLC).
Analysis of permeability of FITC-Dextran beads into the HBMECs monolayer
HBMECs were seeded into 24-well Transculture inserts with pore sizes of 0.4 µm (Corning Inc., Corning, NY) at a density of 105 cells per well and incubated in 5% CO2 incubator at 37°C for 48 hours to form a tight monolayer of cells. The cell culture medium was replaced every 24 hours with fresh medium. The cells were treated with EVs derived from HIV-1 infected or uninfected cocaine treated or untreated macrophages and incubated for 72 hours. FITC-Dextran having a molecular weight of 70 kDa was then added to the apical chamber of each Transculture well and incubated for 30 minutes in 5% CO2 incubator at 37 °C. Permeability was analyzed by the endothelial transcellular passage of FITC-Dextran using fluorescence place reader.
ELISA
Cell culture supernatants from different treatment and infection conditions were analyzed for TNF-α, IL-1β and IL-6 levels by corresponding ELISA kits according to the manufacturer's protocol (Chondrex, Inc., Redmond WA). P24 ELISA was performed using Zeptometrix ELISA kit according to the manufacturer's protocol (Zeptometrix Corporation, Buffalo NY). Supernatants were stored at −80°C.
Trans-Endothelial Electric Resistance (TEER) Assay
Human Brain Endothelial Cells (HBMEC) were seeded into 96 wells (96W10idf PET, Applied Biophysics, Inc. Troy, NY) standard plate configuration containing two circular 350 μm diameter active electrodes on a transparent PET substrate (measuring from 100 to 200 cells) at a density of 5×104 cells per well and incubated in 5% CO2 incubator at 37°C for 24 hours to form a uniform monolayer of cells. Cells were treated with or without 10 µM cocaine, infected with or without 10 ng/ml HIV-1. TEER was measured at various time intervals using Electric Cell-Substrate Impedance Sensing (ECIS) Ztheta 96 well array station (Applied BioPhysics, Inc.). Prior to the treatment the basal TEER was measured and confirmed the uniform resistance of monolayer in all the wells by measuring the TEER at 4000 Hz. TEER changes were calculated by taking TEER untreated monolayer as 100% at specific time point and calculated the changes in TEER of treated monolayer accordingly.
Statistical analysis
All experiments were performed in triplicates. Differences between untreated and HIV-1 and/or Cocaine treated samples were calculated using a standard 2-tailed Student’s t-test. P-values ≤ 0.05 were considered statistically significant.
