The cloning strategy [9, 10] and the purified recombinant proteins are depicted in Fig. 1. pETgag2 was made by digestion of pETgagl [11] with AdeI, T4 DNA polymerase treatment, and recutting with NdeI. A 1.9 kb gag gene (aa 1–625 of 648 aa) was inserted into pET22b (Novagen) in-frame to the C-terminal histidine tag after SacI, T4 DNA polymerase, and NdeI treatment. The PFV pol domain encoding the 85 kD PR, RT, and RNaseH subunits was amplified with primers #1217 (5'tc cacatatgaatcctcttcagctgttacagccgc) and #1414 (5'tattacactcgagcacataacttccttg), which bear NdeI and XhoI restriction sites (underlined). pETpol2 was made from pET22b and the amplimer using these enzymes. The integrase (IN; aa 751–1143) construct pETpol3 was made alike with #1219 (5'gttatgtgcatatgtgtaataccaaaaaacc) and #1413(5'tgcgctctcgagatttttttccaaatg). All plasmids were sequenced in their FV parts to verify correct insertions and to exclude PCR artifacts.

BL21(DE3)pLys (Novagen) served as a host strain for recombinant proteins. Expression was induced with 1 mM isopropyl-β-D-thiogalactopyranoside. The proteins were purified on Ni²⁺-chelate columns under denaturing conditions with 6 M urea. After renaturation in dialysis buffer (150 mM NaCl, 1 mM EDTA pH 5,0, 20 mM Tric-HCL pH 7,5) the amounts of purified proteins in the eluted fractions were determined by a BCA assay (Pierce). Proteins were subjected to sodium-dodecyl-sulfate-containing 7.5% polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie-blue stain. The purity was analyzed by digital imaging (Phoretix 1D Advanced Version 4.01).

We first estimated the amount of Pol proteins present in FV infected cells. In addition, we determined the sensitivity of the MABs in detecting Gag and Pol protein species. A cellular lysate was prepared from BHK-21 cells lytically infected with PFV, which was obtained by transfection of 293T cells with the pcHSRV2 infectious molecular clone by calcium phosphate coprecipitation [12]. Proteins in the lysates were analysed with the Gag and Pol hybridomas SGG1 (recognizing Gag), 15E10 (PR/RT/RnaseH), and 3E11 (IN) [11, 13] in an immunoblot along with defined amounts of recombinant Gag and Pol proteins purified from bacteria. As shown in Fig. 2, the MAB 3E11 has a detection limit of approx. 10 ng of IN protein expressed in bacteria, while the RT (15E10) and Gag (SGG1) MABs were able to detect 20 ng and 40 ng of the respective proteins from bacteria. This experiment further revealed that the method to detect FV Gag and Pol by the ECLplus reagent (Amersham-Pharmacia) was in a linear range from 10 to more than 100 ng of recombinant protein (Fig. 2 and data not shown). The IgG concentrations of the hybridomas used in this particular experiment were determined, following a published protocol (Mouse-IgG-ELISA, Roche), to be 3.2μg/ml (3E11), 10.5 μg/ml (15E10), and 10.1 μg/ml (SGG1). In conclusion, the IN MAB was at least 12 times more sensitive than the Gag MAB and approx. 6.5 times more than the RT antibody.

Due to the presence of five Gag and Pol molecule species of different molecular weights (pr71^Gag, p68^Gag, pr127^Po1, p85^RT, and p40^IN) it was not possible to calculate exactly the respective molecule numbers present in infected cells. However, the comparison of the intensity of the lanes corresponding to Gag (pr71/p68) and Pol (pr127/p85/p40) proteins, which were detected by the MABs in the lysates, indicated that high amounts of Pol are expressed upon lytic infection in BHK-21 cells. This correlates well with the published amount of pol-specific mRNA, reported to equal the full-length or gag-specific mRNA in the bovine FV system [14]. The ease, with which Pol proteins can be detected in FV infected cells is indicative of their relatively high expression level compared to Gag. This finding questions the theoretical assumption of only trace amounts of Pol in FV particles. Obviously, FV utilizes distinct ways to avoid overloading infected cells with Pol protein. High cellular loads of retroviral Pol proteins can be associated with cell toxicity [15]. Although not necessary to incorporate high amounts of RT in FV particles, this abundance of FV Pol proteins in infected cells may have other yet undiscovered reasons in FV biology.

We generated highly purified virus by consecutive centrifugation through a sucrose cushion and a linear gradient made of iodixanol. BHK-21 cells were infected with the supernatant from transfected 293T cells and cell-free virus was harvested when productive infection was ongoing, usually after 3–5 days. The supernatant was clarified from cellular debris by low-speed centrifugation and filtered through a 0.45μm pore-size filter (Sartorius). Virus was concentrated by centrifugation through a 20% sucrose cushion in TNE buffer (20 mM TRIS-HC1, pH 7.5, 150 mM NaC1, 1 mM EDTA) in a SW28 rotor (Beckman) at 25,000 rpm, 4°C for 1 hr. The sediment was resolved in Dulbecco's minimal essential medium (DMEM) and placed on a 2 ml 10–40% continuous iodixanol (OptiPrep from Axis-Shield) gradient for further virus purification. The gradient was cast in a gradient mixer (SG30 from Hoefer) the day before use. Following centrifugation in a TLS-55 rotor (Beckman) at 48,000 rpm and 4°C for 4 hrs, 200 μl fractions were taken from the top. From each fraction 30 μl were used for the determination of the refraction index, 20 μ1 for infectivity assay on BHK/LTR(PFV)lacZ cells [16], and l00 μl for immunoblotting.

As exemplified in Fig. 3A, fractions 5 and 6 were the main gradient fractions in which viral Gag and Pol proteins were detected by immunoblotting. Fraction 6 was also the main fraction of viral infectivity as shown in Fig. 3B. A mean density of 1.119 g/ml (± 0.011) was found for infectious PFV particles. This value is slightly lower than previous results with sucrose gradients [3, 17, 18]. Defined amounts of bacterially-expressed Gag and Pol proteins were also applied to the gel. The intensities of the bands were determined with a LAS-3000 (Fujifilm) and the relative amounts of Gag and Pol proteins were calculated using the software Image Gauge 3.01 (Fujifilm). A regression curve was formed, in which the total amounts of recombinant protein loaded in each lane were related to the optical densities of the individual protein bands which were produced after blotting, reaction with MABs, and ECLplus staining. In Fig. 4 an example is depicted, which was derived from the same samples shown in Fig. 3. The ability to build a regression curve from the sample detection also illustrates that the assay was linear over the protein range analyzed.

As detailed above, the reasons to assume that only trace amounts of Pol protein are encased in spumaretrovirus virions were hitherto largely theoretical. We provide here experimental evidence that many more Pol molecules per capsid can be found in purified FVs than was previously thought, even when taking into account that we did not determine the absolute numbers of molecules per virion, but only the relative Gag to Pol ratios. How can this finding be explained in the light of recent results in which two distinct RNA structures were identified to be essential for Pol protein incorporation into FV particles [4]? Firstly, with respect to this study only the minimal RNA sequence requirements for Pol protein encapsidation using subgenomic constructs have been determined, and not the relative ratios between Gag and Pol using a full-length viral genome. Secondly, it may be that the presence of the RNA domains, found to be responsible for Pol packaging, leads to the encapsidation of not only two Pol molecules per viral RNA, but of a larger complex which consists of many more protein molecules. This complex may be stabilized by protein-protein interactions between Pol and Gag, the individual Pol molecules, or a combination of both.