Skip to main content
Download PDF

Reduced CCR5 expression among Uganda HIV controllers

Retrovirology volume 20, Article number: 8 (2023) Cite this article

Abstract

Background

Several mechanisms including reduced CCR5 expression, protective HLA, viral restriction factors, broadly neutralizing antibodies, and more efficient T-cell responses, have been reported to account for HIV control among HIV controllers. However, no one mechanism universally accounts for HIV control among all controllers. In this study we determined whether reduced CCR5 expression accounts for HIV control among Ugandan HIV controllers. We determined CCR5 expression among Ugandan HIV controllers compared with treated HIV non-controllers through ex-vivo characterization of CD4 + T cells isolated from archived PBMCs collected from the two distinct groups.

Results

The percentage of CCR5 + CD4 + T cells was similar between HIV controllers and treated HIV non-controllers (ECs vs. NCs, P = 0.6010; VCs vs. NCs, P = 0.0702) but T cells from controllers had significantly reduced CCR5 expression on their cell surface (ECs vs. NCs, P = 0.0210; VCs vs. NCs, P = 0.0312). Furthermore, we identified rs1799987 SNP among a subset of HIV controllers, a mutation previously reported to reduce CCR5 expression. In stark contrast, we identified the rs41469351 SNP to be common among HIV non-controllers. This SNP has previously been shown to be associated with increased perinatal HIV transmission, vaginal shedding of HIV-infected cells and increased risk of death.

Conclusion

CCR5 has a non-redundant role in HIV control among Ugandan HIV controllers. HIV controllers maintain high CD4 + T cells despite being ART naïve partly because their CD4 + T cells have significantly reduced CCR5 densities.

Introduction

CCR5 is not only a chemokine receptor expressed by several immune cells, including T cells, macrophages, and dendritic cells, but it is also required by the R5 HIV tropic virus to infect CD4 + T cells [1,2,3]. Mutations in the gene encoding CCR5 for example, the \(\varDelta\) 32 bp deletion, have been associated with either delayed progression to AIDS or resistance to HIV infection [4,5,6,7,8,9]. This knowledge has led to the development of drugs that competitively bind CCR5 to reduce viral entry and CD4 + T cell depletion [10,11,12]. Understanding host-pathogen interaction and deciphering immune correlates of protection is vital to identifying therapeutic and drug design targets. This study determined whether CCR5 accounts for HIV control among Ugandan HIV controllers. These individuals have the intrinsic capacity to delay HIV progression to AIDS without antiretroviral therapies. Generally, mechanisms underlying HIV control among controllers remain unknown and those reported vary among different populations.

HIV controllers have been reported in Uganda but the mechanisms for their HIV control remain largely unknown [13,14,15]. Variations in the expression of several host factors including HLA, CCR5, and viral restriction factors, have been reported as underlying factors associated with this phenotype [16,17,18,19,20]. However, mechanisms for HIV control are heterogeneous with no one mechanism accounting for HIV control among all controllers. HLA, for example, only accounts for approximately 20% of HIV controllers with some individuals with the perceived protective HLA progressing rapidly to AIDS. Furthermore, in 2020, Amanya and colleagues reported that a subset of Ugandan HIV controllers carry the rs10838525 SNP (R136Q variant) within the Trim 5a encoding gene [21]. TRIM 5a is a viral restriction factor that interferes with HIV decapsidation [22]. This mutation enhances the protein’s affinity for HIV-1 and recent reports show it may be superior at blocking HIV-1 infection compared to the wild type [23]. However, it only accounted for a subset of HIV controllers.

Our study determined whether reduced CCR5 accounts for HIV control among Ugandan HIV controllers. Previous studies have reported that reduced CCR5 expression protects CD4 + T cells from infection by the R5 tropic virus impairing viral entry and replication thus impeding HIV progression [6, 24]. Despite being ART-naive, HIV controllers maintain comparable CCR5 + CD4 + T cells to treated HIV non-controllers. However, through ex-vivo characterization of CD4 + T cells from HIV controllers, we show that controllers have significantly reduced CCR5 expression which could partly account for the reduced T cell depletion and delayed progression to AIDS.

Results

Clinical characteristics of study participants

We included 14 elite controllers, 10 viremic controllers, and 7 treated HIV non-controllers from the elite study [13]. The participant characteristics are summarized in Table 1 while the detailed demographic and clinical characteristics of study participants are in additional Table 1. All HIV controllers were in care for at least five years without ART. None of the HIV controllers had been initiated on ART during blood collection or previously. The comparison group comprised treated HIV non-controllers who had suppressed HIV viral load and maintained CD4 + T cell count greater than 500 cells/ul for at least five years. The mean CD4 + T cell count for all HIV controllers was above 500 cells/ul while the viral load was undetectable in elite controllers and lay between 50 and 2000 copies/ml for viremic controllers.

Table 1 Summary of characteristics of study participants
Full size table

The percentage of CD4 + T cells is comparable between HIV controllers and non-controllers

Many studies, including a recent study by Claireaux and colleagues have reported that HIV controllers maintain high CD4 + T cells without ART [6]. To the contrary, non-controllers require ART to inhibit viral replication, CD4 + T cell depletion, and delayed progression to AIDS. In agreement with previous studies, we found no statistical difference between the CCR5 + CD4 + T cell percentages between HIV controllers and HIV-treated non-controllers (Fig. 1; ECs vs. NCs, P = 0.6010; VCs vs. NCs, P = 0.0702).

Fig. 1
figure 1

Percentage of CCR5 + CD4 + T cells between HIV controllers and non-controllers. EC: Elite controllers, VC: viremic controllers, and NC: non-controllers. Each point represents one individual

Full size image

HIV controllers have reduced CCR5 expression on CD4 + T cells compared to non-controllers

How CD4 + T cells from Uganda HIV controllers avoid infection and depletion upon encountering the virus remains incompletely understood. Recently, Claireaux et al. reported that HIV controllers maintain high CD4 + T cell counts because their T cells have reduced CCR5 expression restricting viral entry and cell depletion [6, 24]. We evaluated whether reduced CCR5 expression could account for this phenotype among Ugandan HIV controllers. We found that HIV controllers had significantly reduced CCR5 expression compared to treated HIV non-controllers (Fig. 2; ECs vs. NCs, P = 0.0210; VCs vs. NCs, P = 0.0312).

Fig. 2
figure 2

CCR5 densities on CD4 + T cells among HIV controllers compared to non-controllers. EC: Elite controllers, VC: viremic controllers, and NC: non-controllers. Each point represents one individual

Full size image

Mutations identified in the promoter region of the CCR5 gene

Many mutations within the CCR5 gene including delta 32 bp deletion, either abrogate or reduce CCR5 expression among HIV controllers [4,5,6,7]. Other studies have reported that increased expression of β-chemokine ligands upon high-avidity antigen/TCR interactions contributes to autocrine CCR5 downregulation in HIV controllers without CCR5 mutations [6, 24]. Whether these factors account for reduced CCR5 expression among Ugandan HIV controllers remains to be determined. We evaluated whether CCR5 promoter polymorphisms contribute to reduced CCR5 expression among Ugandan HIV controllers because the delta 32 bp mutation previously reported to impair CCR5 expression is rare in Africa [25, 26]. Many mutations within the promoter region have been reported to reduce CCR5 expression [27,28,29,30]. We found rs1799987 SNP (-2459 A/G) predominantly among HIV controllers (71.4% of the elite controllers and 60% of the viremic controllers) while rs41469351 (-2132 C/T) SNP was predominantly found among the treated HIV non-controllers (57.1%). From previous studies, rs1799987 SNP has been reported to reduce CCR5 expression while rs41469351 has been associated with increased perinatal HIV transmission and vaginal HIV shedding [27, 30,31,32,33].

Discussion

The reasons underlying delayed HIV progression among Ugandan HIV controllers remain largely undetermined [13, 14, 34]. The mechanisms for HIV control are heterogenous with no one mechanism universal to all HIV controllers [17, 18, 35,36,37]. Amanya and colleagues reported that a subset of Ugandan HIV controllers carries rs10838525 SNP (R136Q variant) within the Trim 5a encoding gene [21]. This SNP increases the affinity of TRIM 5a for HIV capsid thus enhancing interference with viral decapitation [23, 35] suggesting that genetic factors contribute to HIV control mechanisms. In this study, we show that HIV controllers significantly downregulate their expression of CCR5 on CD4 + T cells compared to non-controllers despite their similar levels of CD4 + T cells. Further, we report that rs179998, a SNP known to reduce CCR5 expression may be partly responsible for this low expression because we found it to be highly predominant in the HIV controllers in our study.

Many studies have previously reported that decreased CCR5 expression reduces HIV viral entry and replication [6, 24, 38, 39]. Gonzalo-Gil and colleagues have previously showed that CD4 + T cells from HIV controllers are resistant to infection with the R5 tropic HIV and that this phenotype is reversed by introducing CCR5 [24]. Furthermore, Claireaux and colleagues have recently reported that Gag-specific CD4 + T cells from HIV controllers have downregulated CCR5, significantly decreasing their susceptibility to R5 tropic HIV entry [6]. In agreement with Claireaux and colleagues, we also found that Ugandan HIV controllers have significantly reduced CCR5 expression compared to non-controllers (Fig. 2) but with comparable percentages of CD4 + T cells (Fig. 1). We believe HIV controllers maintain high CD4 + T cell counts partly because their T cells have significantly reduced CCR5 expression which protects them from infection and depletion.

Impaired CCR5 expression can be due to functional or genetic factors [6]. Claireaux and colleagues have shown that a subset of controllers carry biallelic mutations for example, Q280P, which significantly reduce CCR5 expression [6]. Many other mutations have been reported to impair CCR5 expression [28,29,30, 40, 41]. Our focus was on mutations within the promoter region that have been previously reported to reduce CCR5 expression and shown to delay HIV-1 disease progression. We found rs1799987 SNP and rs41469351 SNP among HIV controllers and treated HIV non-controllers respectively. In agreement with McDermott et al. and Knudsen et al., rs1799987 SNP was more pronounced among individuals that delayed progression to AIDS [27, 42]. In several other studies, rs1799987 SNP has been associated with significantly reduced in vitro promoter activity, CCR5 expression, and HIV propagation compared to wild-type ORF [27, 30, 43,44,45,46,47,48].

On the other hand, treated HIV non-controllers predominantly had the rs41469351 SNP. Kostrikis et al. and John et al. have reported that infants with rs41469351 SNP have enhanced susceptibility to HIV − 1 infection [31, 32]. Kostrikis et al. reported that this mutation is associated with increased perinatal HIV transmission. To the contrary, John et al. and Singh et al. did not find such a relationship [32, 33]. However, John et al. reported that women with the rs41469351 SNP had a 3.1-fold increased risk of death during the 2-year follow-up period and significantly increased vaginal shedding of HIV-1–infected cells [32]. We believe rs41469351 SNP influences HIV infection, but its impact on CCR5 expression and viral entry remains to be determined.

Because mutations in the CCR5 gene partly account for the reduced CCR5 expression among HIV controllers, other mechanisms that could account for this phenotype have been explored. Claireaux and colleagues have recently reported that increased expression of β-chemokine ligands upon high-avidity antigen/TCR interactions contributes to autocrine CCR5 downregulation in controllers without CCR5 mutations [6]. We believe a similar mechanism could explain the reduced CCR5 expression among the remaining subset of Ugandan HIV controllers who do not carry mutations associated with reduced CCR5 expression.

Conclusion

HIV controllers maintain comparable CCR5 + CD4 + T cells to treated HIV patients, and this could be partly because of the significantly reduced CCR5 expression. Reasons for the reduced CCR5 expression among Ugandan HIV controllers remain to be determined, but we identified rs1799987 SNP among a subset of controllers. This SNP has been previously reported to reduce CCR5 expression.

Limitations of the study

The study population was constrained because participants were recruited at a time when the test and treat policy was being initiated in Uganda. All individuals that were initiated on treatment by the time of enrolment were excluded regardless of their previous HIV control status. Furthermore, we were unable to include healthy HIV unexposed or exposed controls, but previous studies show that HIV controllers have reduced CCR5 expression compared to both non-controllers and healthy uninfected individuals [24, 49, 50].

Methods

The aim, research design, and setting of the study

This laboratory-based cross-sectional study was conducted to characterize CCR5 expression between HIV controllers and treated HIV non-controllers in Uganda. We utilized PBMCs from the Elite study that recruited participants from Makerere University Joint Aids Program (MJAP) ISS clinic between 2016 and 2018 in Uganda [13]. The immunology experiments were conducted at Makerere University College of Health Sciences, Molecular and Immunology Laboratory. The molecular biology experiments were conducted at the Center for AIDS Research (CFAR) laboratory, Joint Clinical Research Center in Kampala, Uganda.

Participant characteristics

The study utilized PBMCs collected by the elite study [13]. Before implementing the test and treat policy, the Elite study recruited HIV+, ART-naive individuals aged 18 years and older who were under care for at least five years at Makerere University Joint AIDS Program (MJAP), Mulago ISS clinic in Kampala, Uganda [13]. Patient records were reviewed, and individuals that maintained baseline viral load below 2000 copies per milliliter and serial CD4 counts greater than 500 cells/ml in the absence of ART were recruited. The study participants were classified into the elite (< 50 copies/ml) and viremic controllers (50–2000 copies/ml) based on their HIV viral load. The control group included treated HIV + non-controllers who suppressed HIV for at least five years. The study excluded individuals with hemoglobin of 10 mg/dL or active opportunistic infection. The School of Biomedical Sciences, Higher Degrees Research and Ethics Committee (SBS HDREC), Makerere University (SBS-604) approved the research.

Laboratory methods

Sample processing and thawing

PBMCs were retrieved from liquid nitrogen and immediately thawed in a water bath set at 37 °C. After that, they were transferred into 10 ml of R-10 media and centrifuged at 1500 rpm for 10 min. The supernatant was decanted, and the pellet was resuspended in 5 ml R-10 media (10% FBS, 1% Pen-strep, 1% L-Glutamine, 1% Hepes Buffer) RPMI) for counting. The cells were stained with trypan blue and counted using an automatic cell counter (Invitrogen, Carlsbad, California, USA).

CCR5 phenotyping

CD4 T cells were isolated from PBMCs retrieved from liquid nitrogen using the EasySep™ Human Isolation Kit (Stem Cell Technologies) according to the manufacturer’s protocol. The isolated cells were assessed for purity using flow cytometry. Briefly, cells were stained with anti-CD3 and anti-CD4 and ran on the BD FACS Canto II (BD Biosciences, Franklin Lakes, New Jersey, USA). Samples with an average purity of ≥ 95% were considered for stimulation. CD4 + T cells were then stimulated with anti-CD3 (eBioscience Clone CD28.2) and anti-CD28 (eBioscience clone OKT3) at a 5 µg/ml concentration each and incubated for 48 h at 370 C in a CO2 incubator. After incubation, cells were washed and stained for CCR5 phenotyping monoclonal antibodies. Cells were stained with Zombie aqua and antibodies against CD3, CD4, and CCR5 (BD bioscience, San Jose, CA, USA) and were acquired on an eight-color FACS CANTO II (BD Biosciences, San Jose, CA, USA). Data were analyzed using FlowJo version 10.1 (San Carlos, CA, USA). The gating strategy used is shown in Additional Fig. 1.

DNA extraction and PCR amplification

DNA was extracted from CD4 + T cells using the QIAamp DNA mini-Kit (Qiagen, Inc., Valencia, CA, USA) per the manufacturer’s instructions. The CCR5 promoter region was amplified as described by Picton et al. [51]. Briefly, a PCR master mix was prepared with high fidelity Super script III platinum Taq polymerase (Invitrogen, Carlsbad, CA, USA), 2X reaction buffer, 5 Mm MgCL2 and primers (Forward- 5′CCAAGCACCAGCAATTAGC3′ and Reverse 5′TGCCACCACAGATGAATGTC3′) developed using GenBank sequence with accession number U95626. PCR was run with the following cycling conditions; Initial denaturation at 95 °C for 3 min; 31 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 68 °C for 2.40 min; followed by 68 °C for 7 min. The promoter amplicon size was 2189 base pairs [51].

Sequencing

PCR amplicons were cleaned using the ExoSAP IT and sequenced using an ABI version 3.1 BigDye Kit (Applied Biosystems, Catalogue no. 4,337,456) and ABI3500xl Genetic Analyzer. Briefly, a master mix was prepared as follows; 0.5 µl Big Dye terminator, 1.75 µl 5X sequencing buffer, 2.5 µl primer (sequences in Additional Table 2), and 4.25 µl water. 9 µl of sequencing master mix was added into each well, where 1 µl of DNA was added. PCR amplification was subjected to thermal cycling as follows: 96 °C for 1 min; 30 cycles of denaturation at 96 °C for 30 s, annealing at 60 °C for 30 s, extension at 68 °C for 2.40 min; followed by 68 °C for 7 min.

Sanger sequence data analysis

Mutation surveyor version 5.5 (Soft Genetics; Pennsylvania, USA) was used to identify mutations. U95626 and NT_022517 reference sequences were used in assembly [52]. The CCR5 numbering system was used where the first nucleotide of the translational start site is designated as + 1, and the nucleotide immediately upstream from that is − 1 [53]. A search of the GenBank NCBI SNP database (dbSNP) determined whether polymorphisms detected in this study had been previously reported.

Statistics

Statistical analysis was performed using GraphPad Prism 7. The Mann-Whitney and Kruskal Wallis test for non-parametric variables facilitated the comparison of differences among groups. P values < 0.05 indicated a significant difference.

Data availability

The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.

Abbreviations

CCR5:

CC chemokine receptor 5

ART:

Antiretroviral therapy

DNA:

Deoxyribonucleic acid

HIV:

Human immunodeficiency virus

MJAP:

Makerere University Joint Aids Program

PBMC:

Peripheral blood mononuclear cells

PCR:

Polymerase chain reaction

RNA:

Ribonucleic Acid

EC:

Elite controllers

NC:

Non-controllers

LTNP:

Long term nonprogressors

References

  1. Deng H, Liu R, Ellmeier W, Choe S, Unutmaz D, Burkhart M, et al. Identification of a major co-receptor for primary isolates of HIV-1. Nature. 1996;381(6584):661–6.

    Article  CAS  PubMed  Google Scholar 

  2. Dragic T, Litwin V, Allaway GP, Martin SR, Huang Y, Nagashima KA, et al. HIV-1 entry into CD4 + cells is mediated by the chemokine receptor CC-CKR-5. Nature. 1996;381(6584):667.

    Article  CAS  PubMed  Google Scholar 

  3. Zaitseva M, Blauvelt A, Lee S, Lapham CK, Kiaus-Kovrun V, Mostowski H, et al. Expression and function of CCR5 and CXCR4 on human Langerhans cells and macrophages: implications for HIV primary infection. Nat Med. 1997;3:1369–75.

    Article  CAS  PubMed  Google Scholar 

  4. Carrington M, Kissner T, Gerrard B, Ivanov S, O’Brien SJ, Dean M. Novel alleles of the chemokine-receptor gene CCR5. Am J Hum Genet. 1997;61(6):1261–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. An P, Martin MP, Nelson GW, Carrington M, Smith MW, Gong K, et al. Influence of CCR5 promoter haplotypes on AIDS progression in African–Americans. Aids. 2000;14(14):2117–22.

    Article  CAS  PubMed  Google Scholar 

  6. Claireaux M, Robinot R, Kervevan J, Patgaonkar M, Staropoli I, Brelot A, et al. Low CCR5 expression protects HIV-specific CD4 + T cells of elite controllers from viral entry. Nat Commun. 2022;13(1):521.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Ansari-Lari MA, Liu X-M, Metzker ML, Rut AR, Gibbs RA. The extent of genetic variation in the CCR5 gene. Nat Genet. 1997;16(3):221–2.

    Article  CAS  PubMed  Google Scholar 

  8. Ometto L, Bertorelle R, Mainardi M, Giurisato M, Chieco-Bianchi L, De Rossi A. Analysis of the CC chemokine receptor 5 m303 mutation in infants born to HIV-1-seropositive mothers. Aids. 1999;13(7):871.

    Article  CAS  PubMed  Google Scholar 

  9. Quillent C, Oberlin E, Braun J, Rousset D, Gonzalez-Canali G, Métais P, et al. HIV-1-resistance phenotype conferred by combination of two separate inherited mutations of CCR5 gene. The Lancet. 1998;351(9095):14–8.

    Article  CAS  Google Scholar 

  10. Hutter G, Nowak D, Mossner M, Ganepola S, Allers K, Schneider T, et al. editors. Treatment of HIV-1 infection by allogeneic CCR5-D32/D32 stem cell transplantation: a promising approach [abstract# 719]. 15th Conference on Retroviruses and Opportunistic Infections; 2008.

  11. Maeda K, Das D, Nakata H, Mitsuya H. CCR5 inhibitors: emergence, success, and challenges. Expert Opin Emerg Drugs. 2012;17(2):135–45.

    Article  CAS  PubMed  Google Scholar 

  12. Tan Q, Zhu Y, Li J, Chen Z, Han GW, Kufareva I, et al. Structure of the CCR5 chemokine receptor–HIV entry inhibitor maraviroc complex. Science. 2013;341(6152):1387–90.

    Article  CAS  PubMed  Google Scholar 

  13. Kayongo A, Gonzalo-Gil E, Gümüşgöz E, Niwaha AJ, Semitala F, Kalyesubula R, et al. Brief report: identification of elite and viremic controllers from a large urban HIV ambulatory center in Kampala, Uganda. J Acquir Immune Defic Syndr. 2018;79(3):394.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Laeyendecker O, Redd AD, Lutalo T, Gray RH, Wawer M, Ssempijja V, et al. Frequency of long-term nonprogressors in HIV-1 seroconverters from Rakai Uganda. J Acquir Immune Defic Syndr. 2009;52(3):316.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Walker WE, Kurscheid S, Joshi S, Lopez CA, Goh G, Choi M, et al. Increased levels of macrophage inflammatory proteins result in resistance to R5-tropic HIV-1 in a subset of elite controllers. J Virol. 2015;89(10):5502–14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Walker BD, Yu XG. Unravelling the mechanisms of durable control of HIV-1. Nat Rev Immunol. 2013;13(7):487–98.

    Article  CAS  PubMed  Google Scholar 

  17. Sáez-Cirión A, Lacabaratz C, Lambotte O, Versmisse P. HIV controllers exhibit potent CD8 T cell capacity to 3 suppress HIV infection ex vivo and peculiar CTL 4 activation phenotype.

  18. Lissina A, Chakrabarti LA, Takiguchi M, Appay V. TCR clonotypes: molecular determinants of T-cell efficacy against HIV. Curr Opin Virol. 2016;16:77–85.

    Article  CAS  PubMed  Google Scholar 

  19. Pereyra F, Jia X, McLaren P, Telenti A, de Bakker P, Walker B. The major genetic determinants of HIV-1 control affect HLA class I peptide presentation. Science (80-)[Internet]. 2010 Dec 10; 330 (6010): 1551–7.

  20. Ferre AL, Hunt PW, McConnell DH, Morris MM, Garcia JC, Pollard RB, et al. HIV controllers with HLA-DRB1* 13 and HLA-DQB1* 06 alleles have strong, polyfunctional mucosal CD4 + T-cell responses. J Virol. 2010;84(21):11020–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Amanya SB. VARIATIONS IN TRIM5α AND CYCLOPHILIN A GENES AMONG HIV-1 ELITE CONTROLLERS AND NON CONTROLLERS IN UGANDA. Makerere University; 2019.

  22. Ganser-Pornillos BK, Pornillos O. Restriction of HIV-1 and other retroviruses by TRIM5. Nat Rev Microbiol. 2019;17(9):546–56.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Javanbakht H, An P, Gold B, Petersen DC, O’Huigin C, Nelson GW, et al. Effects of human TRIM5α polymorphisms on antiretroviral function and susceptibility to human immunodeficiency virus infection. Virology. 2006;354(1):15–27.

    Article  CAS  PubMed  Google Scholar 

  24. Gonzalo-Gil E, Rapuano PB, Ikediobi U, Leibowitz R, Mehta S, Coskun AK, et al. Transcriptional down-regulation of ccr5 in a subset of HIV + controllers and their family members. Elife. 2019;8:e44360.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Salem A-H, Batzer MA. Distribution of the HIV resistance CCR5-∆32 allele among Egyptians and Syrians. Mutat Research/Fundamental Mol Mech Mutagen. 2007;616(1–2):175–80.

    Article  CAS  Google Scholar 

  26. Barmania F, Potgieter M, Pepper MS. Mutations in CC chemokine receptor type 5 (CCR5) in south african individuals. Int J Infect Dis. 2013;17(12):e1148–e53.

    Article  CAS  PubMed  Google Scholar 

  27. McDermott DH, Zimmerman PA, Guignard F, Kleeberger CA, Leitman SF, Murphy PM. CCR5 promoter polymorphism and HIV-1 disease progression. The Lancet. 1998;352(9131):866.

    Article  CAS  Google Scholar 

  28. Mummidi S, Ahuja SS, Gonalez E, Anderson SA, Santiago EN, Stephan KT, et al. Genealogy of the CCR5 locus and chemokine system gene variants associated with altered rates of HIV-1 disease progression. Nat Med. 1998;4:786–93.

    Article  CAS  PubMed  Google Scholar 

  29. Zimmerman PA, Buckler-White A, Alkhatib G, Spalding T, Kubofcik J, Combadiere C, et al. Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk. Mol Med. 1997;3(1):23–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Mehlotra RK. CCR5 promoter polymorphism – 2459G > A: forgotten or ignored? Cells. 2019;8(7):651.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Kostrikis LG, Neumann AU, Thomson B, Korber BT, McHardy P, Karanicolas R, et al. A polymorphism in the regulatory region of the CC-chemokine receptor 5 gene influences perinatal transmission of human immunodeficiency virus type 1 to african-american infants. J Virol. 1999;73(12):10264–71.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. John GC, Bird T, Overbaugh J, Nduati R, Mbori-Ngacha D, Rostron T, et al. CCR5 promoter polymorphisms in a kenyan perinatal human immunodeficiency virus type 1 cohort: association with increased 2-year maternal mortality. J Infect Dis. 2001;184(1):89–92.

    Article  CAS  PubMed  Google Scholar 

  33. Singh KK, Hughes MD, Chen J, Phiri K, Rousseau C, Kuhn L, et al. Associations of chemokine receptor polymorphisms with HIV-1 mother-to-child transmission in sub-saharan Africa: possible modulation of genetic effects by antiretrovirals. J Acquir Immune Defic Syndr. 2008;49(3):259.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Gabagaya G, Rukundo G, Amone A, Wavamunno P, Namale-Matovu J, Lubega I, et al. Prevalence of undetectable and suppressed viral load in HIV-infected pregnant women initiating option B + in Uganda: an observational study nested within a randomized controlled trial. BMC Infect Dis. 2021;21(1):1–7.

    Article  Google Scholar 

  35. Price H, Lacap P, Tuff J, Wachihi C, Kimani J, Ball TB, et al. A Trim5alpha exon 2 polymorphism is associated with protection from HIV-1 infection in Pumwani sexworker cohort. AIDS. 2010;24(12):1813.

    Article  CAS  PubMed  Google Scholar 

  36. Chakrabarti LA, Simon V. Immune mechanisms of HIV control. Curr Opin Immunol. 2010;22(4):488–96.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Pereyra F, Addo MM, Kaufmann DE, Liu Y, Miura T, Rathod A, et al. Genetic and immunologic heterogeneity among persons who control HIV infection in the absence of therapy. J Infect Dis. 2008;197(4):563–71.

    Article  PubMed  Google Scholar 

  38. Meijerink H, Indrati AR, van Crevel R, Joosten I, Koenen H, van der Ven AJ. The number of CCR5 expressing CD4 + T lymphocytes is lower in HIV-infected long-term non-progressors with viral control compared to normal progressors: a cross-sectional study. BMC Infect Dis. 2014;14(1):1–9.

    Article  Google Scholar 

  39. Phetsouphanh C, Aldridge D, Marchi E, Munier CML, Meyerowitz J, Murray L, et al. Maintenance of functional CD57 + cytolytic CD4 + T cells in HIV + elite controllers. Front Immunol. 2019;10:1844.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. van Rij RP, Broersen S, Goudsmit J, Coutinho RA, Schuitemaker H. The role of a stromal cell-derived factor-1 chemokine gene variant in the clinical course of HIV-1 infection. Aids. 1998;12(9):F85–F90.

    Article  PubMed  Google Scholar 

  41. Martin MP, Dean M, Smith MW, Winkler C, Gerrard B, Michael NL, et al. Genetic acceleration of AIDS progression by a promoter variant of CCR5. Science. 1998;282(5395):1907.

    Article  CAS  PubMed  Google Scholar 

  42. Knudsen TB, Kristiansen TB, Katzenstein TL, Eugen-Olsen J. Adverse effect of the CCR5 promoter – 2459A allele on HIV‐1 disease progression. J Med Virol. 2001;65(3):441–4.

    Article  CAS  PubMed  Google Scholar 

  43. Hladik F, Liu H, Speelmon E, Livingston-Rosanoff D, Wilson S, Sakchalathorn P, et al. Combined effect of CCR5-∆32 heterozygosity and the CCR5 promoter polymorphism – 2459 A/G on CCR5 expression and resistance to human immunodeficiency virus type 1 transmission. J Virol. 2005;79(18):11677–84.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Kawamura T, Gulden FO, Sugaya M, McNamara DT, Borris DL, Lederman MM et al. R5 HIV productively infects Langerhans cells, and infection levels are regulated by compound CCR5 polymorphisms. Proceedings of the National Academy of Sciences. 2003;100(14):8401-6.

  45. Mummidi S, Bamshad M, Ahuja SS, Gonzalez E, Feuillet PM, Begum K, et al. Evolution of human and non-human primate CC chemokine receptor 5 gene and mrna: potential roles for haplotype and mrna diversity, differential haplotype-specific transcriptional activity, and altered transcription factor binding to polymorphic nucleotides in the pathogenesis of hiv-1 anD SIMIAN IMMUNODEFICIENCY VIRUS* 210. J Biol Chem. 2000;275(25):18946–61.

    Article  CAS  PubMed  Google Scholar 

  46. Salkowitz JR, Bruse SE, Meyerson H, Valdez H, Mosier DE, Harding CV, et al. CCR5 promoter polymorphism determines macrophage CCR5 density and magnitude of HIV-1 propagation in vitro. Clin Immunol. 2003;108(3):234–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Shieh B, Liau Y-E, Hsieh P-S, Yan Y-P, Wang S-T, Li C. Influence of nucleotide polymorphisms in the CCR2 gene and the CCR5 promoter on the expression of cell surface CCR5 and CXCR4. Int Immunol. 2000;12(9):1311–8.

    Article  CAS  PubMed  Google Scholar 

  48. Joshi A, Punke EB, Sedano M, Beauchamp B, Patel R, Hossenlopp C, et al. CCR5 promoter activity correlates with HIV disease progression by regulating CCR5 cell surface expression and CD4 T cell apoptosis. Sci Rep. 2017;7(1):1–11.

    Article  Google Scholar 

  49. Picton AC, Paximadis M, Koor GW, Bharuthram A, Shalekoff S, Lassauniere R et al. Reduced CCR5 expression and Immune Quiescence in Black South African HIV-1 controllers. Front Immunol. 2021:5348.

  50. Reynes J, Portales P, Segondy M, Baillat V, André P, Avinens O, et al. CD4 T cell surface CCR5 density as a host factor in HIV-1 disease progression. Aids. 2001;15(13):1627–34.

    Article  CAS  PubMed  Google Scholar 

  51. Picton AC, Paximadis M, Tiemessen CT. Genetic variation within the gene encoding the HIV-1 CCR5 coreceptor in two south african populations. Infect Genet Evol. 2010;10(4):487–94.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Li M, Song R, Masciotra S, Soriano V, Spira TJ, Lal RB, et al. Association of CCR5 human haplogroup E with rapid HIV type 1 disease progression. AIDS Res Hum Retroviruses. 2005;21(2):111–5.

    Article  PubMed  Google Scholar 

  53. Mummidi S, Bamshad M, Ahuja SS, Gonzalez E, Feuillet PM, Begum K, et al. Evolution of human and non-human primate CC chemokine receptor 5 gene and mRNA potential roles for haplotype and mRNA diversity, differential haplotype-specific transcriptional activity, and altered transcription factor binding to polymorphic nucleotides in the pathogenesis of HIV-1 and simian immunodeficiency virus. J Biol Chem. 2000;275(25):18946–61.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We sincerely thank Edgar Kigozi and Rose Nabatanzi for their technical guidance during the research and Ms. Geraldine Nalwadda, Department of Immunology and Molecular Biology, for her administrative support. We thank the staff of the Immunology and molecular laboratories at Makerere University and the Center for AIDS Research laboratories at the Joint Clinical Research Center, Kampala, Uganda, for their technical input during the research.

Funding

This work was done as partial fulfillment for Makerere University to award BN a degree of Master of Science in Immunology and Clinical Microbiology to BN. BN was a MITHU fellow, and NIH Fogarty, Grant No. D43TW010319 (MITHU PI: Henry Boom) funded part of the research. The other part of the work was funded by the African Centre of Excellence in Materials, Product Development, and Nanotechnology (ACE_MAPRONANO) Project ID: P151847/IDA 5797-UG.

Author information

Authors and Affiliations

  1. New Jersey Medical School, Rutgers University, New Jersey, USA

    Brian Nyiro

  2. Baylor College of Medicine, Houston, TX, USA

    Sharon Bright Amanya

  3. Department of Immunology and Molecular Biology, Makerere University, Kampala, Uganda

    Brian Nyiro, Sharon Bright Amanya, Alice Bayiyana, Francis Wasswa, Alex Kayongo, Gerald Mboowa, David Patrick Kateete & Obondo James Sande

  4. Makerere University Lung Institute, Kampala, Uganda

    Alex Kayongo

  5. Centre for AIDS Research Laboratory, Joint Clinical Research Centre, Wakiso, Uganda

    Eva Nabulime & Immaculate Nankya

Authors
  1. Brian Nyiro
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Sharon Bright Amanya
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Alice Bayiyana
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Francis Wasswa
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Eva Nabulime
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Alex Kayongo
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Immaculate Nankya
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Gerald Mboowa
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. David Patrick Kateete
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Obondo James Sande
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization, BN, GM, DPK, IN, and OJS; Methodology, BN, SBA, AK, EN, FW, AB, and OJS; BN performed investigation, Data curation, visualization, and project management; Writing—original Draft, NB; Review and editing, BN, SBA, OJS, and AK; Funding Acquisition BN, and OJS; Supervision DPK, IN, and OJS. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Obondo James Sande.

Ethics declarations

Ethics approval and consent to participate

Ethical clearance was obtained from the Makerere University School of Biomedical Sciences Research and Ethics Committee. A waiver of consent was obtained before samples were used.

Consent for publication

Not applicable.

Competing interest

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Nyiro, B., Amanya, S.B., Bayiyana, A. et al. Reduced CCR5 expression among Uganda HIV controllers. Retrovirology 20, 8 (2023). https://doi.org/10.1186/s12977-023-00626-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12977-023-00626-7

Keywords

Retrovirology

ISSN: 1742-4690

Contact us