A complex network of transcription factors and epigenetic regulators involved in bovine leukemia virus transcriptional regulation

Plant, Estelle; Bellefroid, Maxime; Van Lint, Carine

doi:10.1186/s12977-023-00623-w

Table 1 Characteristics of the genomic elements presented in Fig. 1. Genomic coordinates are given relative to the YR2 proviral genome (GenBank KT122858.1). Genomic coordinates in italic are given for the 3’LTR. Nucleotides in bold indicate differences between mature miRNA sequences described in [118] and those in the online database miRBase (https://www.mirbase.org/)

From: A complex network of transcription factors and epigenetic regulators involved in bovine leukemia virus transcriptional regulation

	+ 1 = 1st nt of sense TSS		+ 1 = 1st nt of 5'LTR		Sequence (Positively oriented)	Size (bp)	Reference
Name	Start	End	Start	End	Sequence (Positively oriented)	Size (bp)	Reference
Proviral genome	− 211	8509	1	8720		8720	KT122858.1
LTR	− 211	320	1	531		531	[63]
U3	− 211	− 1	1	211		211	[63]
U3	7978	8188	8190	8400		211	[63]
TxRE1	− 164	− 143	48	68	CAGACAGAGACGTCAGCTGCC	21	[63]
CRE1	− 157	− 149	55	62	AGACGTCA	8	[40]
E-Box1	− 151	− 145	61	66	CAGCTG	6	[40]
TxRE2	− 139	− 118	73	93	AAGCTGGTGACGGCAGCTGGT	21	[40]
CRE2	− 132	− 124	80	87	AGACGTCA	8	[40]
E-Box2	− 126	− 120	86	91	CAGCTG	6	[40]
PU.1/Spi-B	− 95	− 83	117	128	AAAGGGGAAGTT	12	[49]
HSE	− 86	− 76	126	135	TTTCCCGAAA	10	[58]
CAAT box	− 97	− 91	115	120	CCAACT	6	[63]
GRE	− 74	− 59	138	152	TCCACACCCCGAGCT	15	[25]
TxRE3	− 64	− 43	148	168	GAGCTGCTGACCTCACCTGCT	21	[40]
CRE3	− 57	− 49	155	162	AGACGTCA	8	[40]
E-Box3	− 51	− 45	161	166	CACCTG	6	[40]
TATA box	− 43	− 38	169	173	GATAA	5	[63]
R	1	234	212	445		235	[63]
R	8189	8423	8401	8633		235	[63]
TSS sense	1		212				[63]
DAS	146	210	358	421		64	[63]
E-Box4	173	178	384	389	CACGTG	6	[63]
E-Box4	8362	8367	8573	8578	CACGTG	6	[63]
MTE	8405	8416	427	438	CAAGCCAGACGC	12	[98]
DPE	8406	8410	428	432	AGACG	5	[98]
TSS2 antisense	8380		402				[136]
U5	235	320	446	531		85	[63]
U5	8424	8509	8634	8720		85	[63]
TSS1 antisense	8439		8650				[136]
IRF	250	265	461	476	TACTTTCTGTTTCTCG	16	[63]
IRF	8439	8454	8650	8665	TACTTTCTGTTTCTCG	16	[63]
BRE	8475	8481	497	503	GGGCGCC	7	[98]
CTCF	285	303	496	514	TGGCCGCTAGAGGGCGCCG	14	[70]
CTCF	8474	8492	8685	8703	TGGCCGCTAGAGGGCGCCG	14	[70]
miRNA cluster	6186	6700	6397	6910		514
miR-B1-5p	6186	6207	6397	6417	AGGCUGUGGUGGUGCACUGGCUU	22	[118]
miR-B1-3p	6219	6241	6430	6452	UCAGUGUACCAUCACAAGCCUCU	23	[118]
miR-B2-5p	6297	6316	6508	6527	AUGACUGAGUGUAGCGCAGAGA	20	[118]
miR-B2-3p	6331	6352	6542	6563	UGCGUGUCGCUCAGUCAUUUUU	22	[118]
miR-B3-5p	6425	6446	6636	6657	AUCCCCCUGCCAGCGUUGGUCU	22	[118]
miR-B3-3p	6459	6481	6670	6692	UAACGCUGACGGGGGCGAUUUCU	23	[118]
miR-B4-5p	6494	6515	6705	6726	GCGGGAGGCUCUGGUGCUGG	22	[118]
miR-B4-3p	6533	6556	6744	6767	UAGCACCACAGUCUCUGCGCCUUU	24	[118]
miR-B5-5p	6647	6669	6857	6880	AGGAAGGUUGUGGCUCAGAGGU	23	[118]
miR-B5-3p	6678	6700	6889	6911	CUCGAGCCGCAACCUCCCUUUCU	23	[118]

Back to article page

ISSN: 1742-4690

Contact us

Submission enquiries: journalsubmissions@springernature.com

Retrovirology

Contact us