Skip to main content

Advertisement

Table 1 qPCR Primer/probe sets

From: The cooperative function of arginine residues in the Prototype Foamy Virus Gag C-terminus mediates viral and cellular RNA encapsidation

Target Primer/Probe 5′-3′ sequencea Cycle conditions
PFV genome (Integrase 1) fwd CTTCAACCTTTGCTGAATG 95°C, 8 min, 1×
rev TAATACAGGGCTATAGGTGT 95°C, 30 s, 40×
probe FAM-TTGGAATTCAGTACTCCTTATCACCC-BHQ1 58°C, 30 s, 40×
PFV genome (Integrase 2) fwd TGCAATTCCAAAGGTGATTC 95°C, 8 min, 1×
rev TACCTCTTTCCTTTGCCCAT 95°C, 30 s, 40×
probe FAM-TCAAGGTGCAGCATTCACTTCTTCAA-BHQ1 59°C, 30 s, 40×
EGFP fwd GCAGTGCTTCAGCCGCTAC 95°C, 8 min, 1×
rev AAGAAGATGGTGCGCTCCTG 95°C, 30 s, 40×
probe HEX-CCGACCACATGAAGCAGCACGACTT-BHQ2 59°C, 30 s, 40×
72°C, 45 s, 40×
GAPDH fwd CATCAATGGAAATCCCATCA 95°C, 45 s, 40×
rev GACTCCACGACGTACTCAGC 95°C, 30 s, 40×
probe FAM-TCCAGGAGCGAGATCCCTCCA-BHQ1 59°C, 30 s, 40×
72°C, 30 s, 40×
ACTB fwd TGGACTTCGAGCAAGAGATG 95°C, 8 min, 1×
rev GAAGGAAGGCTGGAAGAGTG 95°C, 30 s, 40×
probe FAM-CGGCTGCTTCCAGCTCCTCC-BHQ1 59°C, 30 s, 40×
72°C, 30 s, 40×
ASB1 primer/probe mix HS00211548_m1 Gene Expression Kit Applied Biosystems 95°C, 10 min, 1×
95°C, 15 s, 40×
60°C, 1 min, 40×
PGK1 primer/probe mix HS99999906_m1 Gene Expression Kit Applied Biosystems 95°C, 1 min, 1×
95°C, 15 s, 40×
60°C, 1 min, 40×
PLEKHB2 primer/probe mix HS00215820_m1 Gene Expression Kit Applied Biosystems 95°C, 10 min, 40×
95°C, 15 s, 40×
60°C, 1 min, 40×
  1. aFam: 6-carboxyfluorescein; HEX: hexachloro-fluorescein; BHQ1: Black Hole Quencher 1; BHQ2: Black Hole Quencher 2.