Skip to main content

Table 1 Oligonucleotide sequences for EMSA and pHIV-RL constructs

From: CTGC motifs within the HIV core promoter specify Tat-responsive pre-initiation complexes

Name Sequence
HIV wt CTAGATGCTGCATATAAGCAGCTGCTTTTTGCATG
TATAKO CTAGATGCTGAGAGCTCGCAGCTGCTTTTTGCATG
USF-1+ CTAGATGCTGCATATAAGCACGTGCTTTTTGCATG
USF-KO CTAGATGCTGCATATAAGCGGCCGCTTTTTGCATG
AdMLP CTAGAGGGGCTATAAAAGGGGGTGGGGGCGGCATG
HSP70 CTAGACGACTTATAAAAGCCCAGGGGCAAGGCATG
CTGC-5’ CTAGATGATCCATATAAGCAGCTGCTTTTTGCATG
CTGC-3’ CTAGATGCTGCATATAAGGATATCCTTTTTGCATG
CTGC-5’3’ CTAGATGATCCATATAAGGATATCCTTTTTGCATG
  1. Primers were designed to create a double-stranded template for radioactive labelling for use in EMSA or for direct cloning into XbaI and SphI sites. For brevity only the positive strand oligos are shown. Bold face type indicates nucleotides mutated from the wild type sequence.
\