Skip to main content

Table 1 Names, description and sequences of the primers and probes used for the real-time qPCR for HIV integrated DNA, US RNA, MS RNA, and SS RNA

From: Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cells

Name Description Sequence
MH535 1st rd forward 3'LTR 5' -AACTAGGGAACCCACTGCTTAAG-3'
SB407 1st rd reverse Alu 5' -TGCTGGGATTACAGGCGTGAG-3'
SL75 2nd rd forward 5' -GGAACCCACTGCTTAAGCCTC-3'
SL76 2nd rd reverse 5' -GTCTGAGGGATCTCTAGTTACC-3'
SL72 beacon FAM-CGGTCGAGTGCTTCAAGTAGTGTGTGCCCGTC CGACCG-TAMRA-3'
SL19 US forward 5' - TCTCTAGCAGTGGCGCCCGAACA-3'
SL20 US reverse 5' - TCTCCTTCTAGCCTCCGCTAGTC-3'
SL30 US beacon 5' FAM-CGGGAG TACTCACCAGTCGCCGCCCCTCGCC CTCCCG (Dabcyl) 3'
SL28 MS Forward 5' - CTTAGGCATCTCCTATGGCAGGAA - 3'
SL29 MS reverse 5' - TTCCTTCGGGCCTGTCGGGTCCC - 3'
SL38 MS RNA beacon 5' GGGCCT TCTCTATCAAAGCAACCCACCTCC AGGCCC -3'
0dp 2137 Universal forward 5' CGCACGGCAAGAGGCAGG-3'
0dp 2138 US reverse 5' CCCGCTTAATACCGACGCTCTCG-3'
0dp 2140 MS reverse 5' GTCGGGTCCCCTCGGGATTGG-3'
0dp 2139 SS reverse 5' AGGTTGCATTACATGTACTACTTACTGCTT-3'
  1. LTR = long terminal repeat; US = unspliced HIV RNA; MS = multiply spliced HIV RNA; SS = singly spliced HIV RNA