Skip to main content

Table 2 Primers for RT-PCR

From: Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function

Name Sequence 5' > 3'
A (nuc1b-177) CGAGATCCGTTCACTAATCGAATG
B GGATTAACTGCGAATCGTTCTAGC
C CGAGATCCGTTCACTAATCGAATG
BA1 (β-actin) CATGTGCAAGGCCGGCTTCG
BA4 (β-actin) GAAGGTGTGGTGCCAGATTT