Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 3 qPCR validation of differentially expressed genes

From: Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease

Gene
Symbol
Accesion No. Description Fwd Primer Fwd Primer Seq Rev Primer Rev Primer Seq Paired
Comparison
Cell
Type
FC
qPCR
FC
MA
KLRD1 NM_002262.2 killer cell lectin-like receptor subfamily D, member 1 KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1
IRS2 NM_003749.2 insulin receptor substrate 2 IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga BDLvsVIR CD8 3.8 2.7
GBP1 NM_002053.2 guanylate binding protein 1, interferon-inducible GBP1L aggccacatcctagttctgc GBP1R tccaggagtcattctggttgt BDLvsVIR CD8 -2.5 -2.4
ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2
ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8
BAG3 NM_004281.3 BCL2-associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 -2.4
ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8
PSMB2 NM_002794.3 proteasome subunit, beta type, 2 PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3 2.3
PSMA5 NM_002790.2 proteasome subunit, alpha type, 5 PSMA5L tgaatgcaacaaacattgagc PSMA5R ttcttcctttgtgaacatgtgg VIRvsLTNP CD8 2.7 2.7
C1QB NM_000491.3 complement component 1, q subcomponent, B chain C1QBL ggcctcacaggacaccag C1QBR ccatgggatcttcatcatcata BDLvsVIR CD4 -4.8 -4.8
C1QC NM_172369.3 complement component 1, q subcomponent, C chain C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct BDLvsVIR CD4 -5.6 -4.1
SERPING1 NM_000062.2 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1, SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt BDLvsVIR CD4 -5.0 -2.6
C1QB NM_000491.3 complement component 1, q subcomponent, B chain C1QBL ggcctcacaggacaccag C1QBR ccatgggatcttcatcatcata VIRvsLTNP CD4 6.1 6.0
C1QC NM_172369.3 complement component 1, q subcomponent, C chain C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct VIRvsLTNP CD4 7.3 4.4
SERPING1 NM_000062.2 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1, SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt VIRvsLTNP CD4 5.3 2.8
  1. FC_qPCR: fold change by qPCR; FC_MA: fold change by microarray