Skip to main content

Table 3 qPCR validation of differentially expressed genes

From: Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease

Accesion No. Description Fwd Primer Fwd Primer Seq Rev Primer Rev Primer Seq Paired
KLRD1 NM_002262.2 killer cell lectin-like receptor subfamily D, member 1 KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1
IRS2 NM_003749.2 insulin receptor substrate 2 IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga BDLvsVIR CD8 3.8 2.7
GBP1 NM_002053.2 guanylate binding protein 1, interferon-inducible GBP1L aggccacatcctagttctgc GBP1R tccaggagtcattctggttgt BDLvsVIR CD8 -2.5 -2.4
ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2
ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8
BAG3 NM_004281.3 BCL2-associated athanogene 3 BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 -2.4
ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8
PSMB2 NM_002794.3 proteasome subunit, beta type, 2 PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3 2.3
PSMA5 NM_002790.2 proteasome subunit, alpha type, 5 PSMA5L tgaatgcaacaaacattgagc PSMA5R ttcttcctttgtgaacatgtgg VIRvsLTNP CD8 2.7 2.7
C1QB NM_000491.3 complement component 1, q subcomponent, B chain C1QBL ggcctcacaggacaccag C1QBR ccatgggatcttcatcatcata BDLvsVIR CD4 -4.8 -4.8
C1QC NM_172369.3 complement component 1, q subcomponent, C chain C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct BDLvsVIR CD4 -5.6 -4.1
SERPING1 NM_000062.2 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1, SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt BDLvsVIR CD4 -5.0 -2.6
C1QB NM_000491.3 complement component 1, q subcomponent, B chain C1QBL ggcctcacaggacaccag C1QBR ccatgggatcttcatcatcata VIRvsLTNP CD4 6.1 6.0
C1QC NM_172369.3 complement component 1, q subcomponent, C chain C1QCL aaggatgggtacgacggact C1QCR ttctgccctttgggtcct VIRvsLTNP CD4 7.3 4.4
SERPING1 NM_000062.2 serpin peptidase inhibitor, clade G (C1 inhibitor), member 1, SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt VIRvsLTNP CD4 5.3 2.8
  1. FC_qPCR: fold change by qPCR; FC_MA: fold change by microarray