Skip to main content

Advertisement

Table 2 Primers used in this work

From: HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form

Name Function Position in HXB22 Sequence (5' to 3')
O_envf env PCR OF1 5964-5984 TYTCCTATGGCAGGAAGAAGC
O_envr env PCR OR 9096-9074 TAACCCWTCCAGTCCCCCCTTTT
MO130 env PCR IF 6207-6228 GAGCAGAAGACAGTGGCAATGA
MO147 env PCR IR 8834-8810 CATCCMACTATRCTRCTTTTTGACC
MO150 env sequencing 6976-6955 ATTCCATGTGTACYTTGTACTG
MO151 env sequencing 6859-6880 CAATTCCCATACATTATTGTGC
MO152 env sequencing 7668-7647 CACTTCTCCAATTGTCCRTCAT
MO153 env sequencing 7516-7537 GACAAGCAATGTATGCCCCTCC
MO154 env sequencing 8241-8220 ACCAATTCCACAYACTTGCCCA
MO155 env sequencing 8050-8072 CTGGAACKCTAGTTGGAGTAAT
MO042 gag p24 OF-1 890-909 TAGTATGGGCAAGCAGGGAG
MO024 gag p24 OF-2 508 - 527 AACCCACTGCTTAAGCCTCA
MO044 gag p24 OR 2272-2252 TGCCAAAGAGTGATTTGAGGG
MO043 gag p24 IF 1048-1067 TGYGTRCATCAAARGATAGA
MO045 gag p24 IR 2118-2101 CCCCTTGYTGGAAGGCCA
MO034 5' LTR to gag p24 OF 478 - 479 TGAGCCTGGGAGCTCTCTG
MO186 p24 to env OF 1958 - 1985 TTAARTGTTTCAACTGTGGCAAAGAAGA
MO187 p24 to env OR 6420 - 6445 CAAGCATGKGTAGCCCAGAYATTATG
MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA
MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT
MO191 5' LTR to gag p24 OR 832 - 859 AATGCTGWRAACATGGGTATTACTTCTG
MO192 5' LTR to gag p24 IR 786 - 814 TCTATTACTTTYACCCATGCATTTAAAGT
MO193 env to 3' LTR IF 7922 - 7944 CAGACCCTTATCCCAAACCCAAC
MO194 env to 3'LTR IR 8606 - 8629 CCCCCCTTTTCTTTTAAAAAGWRGC
AJB-1R p24 to env sequencing 2239 - 2262 TATGGATTTTCAGGYCCAATTYTTG
AJB-2F p24 to env sequencing 2036 - 2058 GCCCAAARGTTAAACAATGGCCA
AJB-3R p24 to env sequencing 2846 - 2871 TTCTGTATRTCATTGACAGTCCAGCT
AJB-4F p24 to env sequencing 2741 - 2765 ACACCAGAYAARAARCATCAGAAAG
AJB-5R p24 to env sequencing 3585 - 3610 GATTCCTAATGCATACTGTGAGTCTG
AJB-6F p24 to env sequencing 3585 - 3610 CAGACTCACAGTATGCATTAGGAATC
AJB-7R p24 to env sequencing 3722 - 3750 ACTAATTTATCTACTTGTTCATTTCCGCC
AJB-8R p24 to env sequencing 4357 - 4383 ATGTCTAYTATTCTTTCCCCTGCACTG
AJB-9F p24 to env sequencing 4196 - 4219 ATTCCCTACAATCCCCAAAGMCARG
AJB-10F p24 to env sequencing 4609 - 4633 TGATTGTGTGGCARGTAGACAGGAT
AJB-11R p24 to env sequencing 4830 - 4854 TCCATTCTATGGAGACYCCMTGACC
AJB-12R p24 to env sequencing 5498 - 5521 TGCCATAGGARATGCCTAAGCCYTT
AJB-13F p24 to env sequencing 5498 - 5521 AARGGCTTAGGCATYTCCTATGGCA
  1. 1Abbreviations:OF, outer forward;, OR, outer reverse; IF, inner forward, IR, inner reverse.
  2. 2 HXB2 numbering is based on sequence with accession number K03455