Figure 3

Study of FLSD' heterodimerization by RNA Capture Assay (RCA). Details of the procedure were provided previously [36]. Briefly, two-days after transfection, RNAs were extracted from both cells and purified virions. An aliquot (1/5) of the RNA sample extracted from released virions was used for the input sample, whereas the rest (4/5) of the RNA sample was subject to the capture assay by using the 3'-biotinylated anti-MLV pol oligonucleotide (5' CAGTCTCTGTATGTGGGGCTTG 3'). Oligonucleotide-bound RNA was recovered by magnetic streptavidin-coated beads by using a magnetic stand. After several washes, the bound RNA was eluted by heating at 85°C for 5 minutes in water (elution sample). RNAs in elution sample were ethanol precipitated with 15 μg of carrier tRNA. Levels of FL and SD' RNAs were determined in cell extract, input and elution samples by specific RT-QPCR [36].