Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 DNA oligonucleotides used in the present study

From: Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein

Oligo DNA Sequence and position on Tat mRNA
LeaderR sense EcoRI 5' GAATTCGGTCTCTCTGGTTAGACCAGATC 3'
(exon1 sense for Tat1 et Tat2: 1→)
Leader rev1 5' TATTCTGCTATGTCGACACCCAATTCAGTCGCCGCCCCTCG 3'
(exon1 reverse for Tat1:← 290)
Leader rev2 5' GGATCTCTGCTGTCCCTGCAGTCGCCGCCCCTCG 3'
(exon1 reverse for Tat2:← 290)
Ex2Tat sense 5' AATTGGGTGTCGACATAGCAGAATAGGCG 3'
(exon2 sense for Tat1:290→ and for Tat2:343→)
Ex2Tat rev 5'GGGATTGGGAGGTGGGTTGCTTTGATAGAGAAGCTTGATGAGTCTGACTG3' (exon2: reverse for Tat1:← 558 and for Tat2:← 611)
Ex'Tat sense 5'CAGGGACAGCAGAGATCCAGTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAG 3' (exon':sense for Tat2:290→)
Ex'Tat rev 5' CTGCTATGTCGACACCCAATTCTTTCCAGAGGAGCTTTGCTG 3'
(exon':reverse for Tat2:← 343)
Ex3Tat sense 5' ACCCACCTCCCAATCCCGAG 3'
(exon3: sense for Tat1:558→ and for Tat2: 611→)
Tatrev NotI 5' TAATAATGCGGCCGCAGTACAGGCAAAAAGCAGCTGCTTATATGC 3'
(exon3: reverse for Tat1:← 1718 and for Tat2:← 1770)
PBSEcoRI sense 5' TATATTAGAATTCGTGTGCCCGTCTGTTGTGTGACT 3'
(exon1: sense for Tat1 and for Tat2:104 →)
SDEcoRI sense 5' ATATAAGAATTCCGAGGGGCGGCGACTG 3'
(exon1: sense for Tat1 and for Tat2:274→)
AUGEcoRI sense 5' TATAATAGAATTCATGGAGCCAGTAGATCCTAGACTAGAG 3'
(exon2: sense for Tat1:343 → and for Tat2:396 →)
TatNcoI sense 5' TAATATACCATGGGGTCTCTCTGGTTAGACCAGATC 3'
(exon1: sense for Tat1 and for Tat2:1→)
TatSmaI rev 5' TATATACCCGGGAGTACAGGCAAAAAGCAGCTGCTTATATGC 3'
(exon3: reverse for Tat1:← 1718 and for Tat2:← 1770)
TatXbaI sense 5' ATATATTCTAGAGGTCTCTCTGGTTAGACCAGATC 3'
(exon 1:for Tat1 et Tat2:1→)
TatXbaI rev 5' TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3'
(exon3 reverse for Tat1:← 1718 and for Tat2:← 1770)
(111)NcoI rev 5' TATATACCATGGGGCACACACTACTTTGAGCACTCAAGG 3'
(exon1:reverse:← 111)
UTRTatNcoI rev 5' TATATTACCATGGTTCTTGCTCTCCTCTGTCGAGTAACG 3'
(exon2: reverse for Tat1:← 342 and for Tat2:← 395)
(1-336)NcoI rev 5' ATATATACCATGGCTCTCTCCTTCTAGCCTCCGC 3'
(reverse: 5' to AUG of the RNAg)
UTR2TatNcoI sense 5' TAATATACCATGGGTGTGCCCGTCTGTTGTGTGACT 3'
(exon1: sense for Tat1 and for Tat2:104 →)
LTRPvuII sense 5' TAATATACAGCTGTGGAAGGGCTAATTTGGTCCC 3' (sense for U3)
LTRPvuII rev 5' TATATTACAGCTGAGTACAGGCAAAAAGCAGCTGC 3' (reverse for U3)