Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Primer sets for RT PCR

From: Analysis of the contribution of cellular and viral RNA to the packaging of APOBEC3G into HIV-1 virions

Target Primer Sets
  forward reverse
α-tubulin 1) cacccgtcttcagggcttcttggttt catttcaccatctggttggctggctc
GAPDH 2) gaaggtgaaggtcggagtc gaagatggtgatgggatttc
β-actin 3) atggatgatgatatcgccgcg ctagaagcatttgcggtggacg
7SL 3) gggctgtagtgcgctatgc cccgggaggtcaccatatt
Vif gatggcaggtgatgattgtgtgg ctgtccattcattgtatggc
hY1 4) ggctggtccgaaggtagtga aaagactagtcaagtgcagtagtgag
hY3 4) ggctggtccgagtgcagtg aaaggctagtcaagtgaagcagtgg
hY4 4) ggctggtccgagtgcagtg aaagccagtcaaatttagcagtggg
hY5 4) agttggtccgagtgttgtggg aaaacatgcaagctagtcaagcgcg
U1 5) cctggcaggggagataccatgatcacg ggggaaagcgcgaacgcagtccccc
U2 5) cttcttggccttttagctaagatc ggtgcactgttcctggaggtactgc
U4 5) gctttgcgcagtggcagtatcg cagtctccgtagagactgtcaaaaattg
U6 5) gtgctcgcttcggcagcacatatac ggaacgcttcacgaatttgcg
  1. 1) Eppendorf cMaster RTplusPCR system (Eppendorf Inc. Westbury, NY)
  2. 2) Funaki et al. 2003 [54]
  3. 3) Onafuwa-Nuga et al. 2006 [28]
  4. 4) Chiu et al 2006 [22]
  5. 5) Giles et al. 2004 [41]