Skip to main content

Table 1 List of primers and probes used in this study

From: Vpx enhances innate immune responses independently of SAMHD1 during HIV-1 infection

Primer/Probe Sequence (5′−3′) References
PERT-F TCCTGCTCAACTTCCTGTCGAG Horie et al. [43]
PERT-R CACAGGTCAAACCTCCTAGGAATG
PERT-Probe TCTTTAGCGAGACGCTACCATGGCTA
IFNB1-F TTGACATCCCTGAGGAGATTAAGC Hillyer et al. [44]
IFNB1-R TTAGCCAGGAGGTTCTCAACAATAG
IFNB1-Probe CCAGAAGGAGGACGCCGCATTGACC
HRPT1-F TCTTTGCTGACCTGCTGGATT This paper
HPRT1-R TTATGTCCCCTGTTGACTGGT
HPRT1-probe AGTGATAGATCCATTCCTATGACTGT
IFIT1-F AACAGGTTTTCGCAATCAGGC
IFIT1-R GCTCCAGACTATCCTTGACCTG
IFIT1-probe AGATTGCCTCCTCCCTGGAA
IFIT2-F AACAGCTGAGAATTGCACTGC
IFIT2-R GCCAGTAGGTTGCACATTGTG
IFIT2-probe TTCCTTGGAGAGCAGCCTAC
MX1-F ATCCTGGGATTTTGGGGCTT Sumner et al. [28]
MX1-R CCGCTTGTCGCTGGTGTCG
CXCL10-F TGGCATTCAAGGAGTACCTC
CXCL10-R TTGTAGCAATGATCTCAACACG
IFI44L-F GTATAGCATATGTGGCCTTGCTTACT Zahoor et al. [45]
IFI44L-R ATGACCCGGCTTTGAGAAGTC
IFI27-F GGCAGCCTTGTGGCTACTCT
IFI27-R ATGGAGCCCAGGATGAACTTG
ISG15-F ACTCATCTTTGCCAGTACAGGAG
ISG15-R CAGCATCTTCACCGTCAGGTC
Primer/Probe sets Catalog number Company
IFNB1 Hs01077958_s1 ThermoFisher
CXCL10 Hs00171042_m1
IFIT1 Hs01675197_m1
IFIT2 Hs00533665_m1
HPRT1 Hs02800695_m1
GAPDH Hs02786624_g1
\