Skip to main content

Table 2 Primers and probes used for HTLV-1 Gene expression, proviral load, and PCR for sequencing

From: HTLV-1 CTCF-binding site is dispensable for in vitro immortalization and persistent infection in vivo

mRNAPlasmid standardPrimers and probe
 HbzJA6625′ Primer[HBZMAP1] 5′-1905CTTCTAAGGATAGCAAACCGTCAAG1881-3′
  Probe[TMP-13] 5′-/56-FAM/1782CCTGTGCCA/ZEN/TGCCCGGAGGA1801/3IABkFQ/-3′
  3′ Primer[HBZMAP2] 5′-353ATGGCGGCCTCAG365^1765GGCT1768-3′
 rGAPDHrGAPDH5′ Primer[rGAPDH-S] 5′-GATGCTGGTGCCGAGTACGTG-3′
  Probe[BY-1Z] 5′-/56-FAM/ACCACCATG/ZEN/GAGAAGGCCGGG/3IABkFQ/-3′
  3′ Primer[rGAPDH-AS] 5′- GTGGTGCAGGATGCGTTGCTGA-3′
 Gag/PolACHneo5′ Primer[#20] 5′-938AGCCCCCAGTTCATGCAGACC958-3′
  Probe[TMP-3] 5′-/56-FAM/990CTGCCAAAG/ZEN/ACCTCCAAGACCTCC1013/3IABkFQ/-3′
  3′ Primer[#19] 5′-1036GAGGGAGGAGCAAAGGTACTG1016-3′
Gene
 Gag/PolACHneo5′ Primer[#20] 5′-938AGCCCCCAGTTCATGCAGACC958-3′
  Probe[TMP-3] 5′-/56-FAM/990CTGCCAAAG/ZEN/ACCTCCAAGACCTCC1013/3IABkFQ/-3′
  3′ Primer[#19] 5′-1036GAGGGAGGAGCAAAGGTACTG1016-3′
Region of interestPlasmid standardPrimers
vCTCF-BSNA5′ Primer[CTCF-F2] 5′-6826TAGCACTATGCTGTTTCGCCT6846-3′
  3′ Primer[CTCF-R2] 5′-7211GGTGGACGGGCTATTATCTT7192-3′
  1. All provided sequence numbering is in the context of the HTLV-1 molecular clone ACHneo