Skip to main content

Table 2 Primers used for cloning and PCR detection

From: Replacement of feline foamy virus bet by feline immunodeficiency virus vif yields replicative virus with novel vaccine candidate potential

Primer name Sequence (5′–3′)
pCF7-Vif cloning
FFV-Vif #1 GCGGGCTAGCGCCGCGGTACACACCGTCAAAGCCATGAGCGAGGGGACTGGCAG
FFV-Vif #2 GTGCTCTCCAAAGACCGGTTATCACAGCTCGCCGCTCCACAGCAGATTCC
FFV-Vif #3 GGCGAGCTGTGATAACCGGTCTTTGGAGAGCACAAGCTGATG
FFV-Vif #4 CGCTCTGTTGCATGCCG
Mutagenesis of the upstream start codon
FFV 9233-F GCGGTCCGGAACACCCAAGACGGATCCTACTCG
M/T-R CGGCGCTAGCTCTAGTTAGCGTAGTCAAATCCCTCTCCCCAC
M+-R CGGCGCTAGCTCTAGTTACCATAGTGAAATCCCTCTCCCCAC
PCR amplification of in vitro-selected FFV-Vif variants
FFV 9366-F CCACTTCTGTTTGGACCTTACC
FFV-10288-R CAGCTTGTGCTCTCCAAAGC
Nested FFV PCR
FFVgag-F1 CTACAGCCGCTATTGAAGGAG
FFVgag-R1 CCCTGCTGTTGAGGATTACC
FFVgag-F2 TTACAGATGGAAACTGGTCCTTAGT
FFVgag-R2 CATCAGAGTGTTGCTGTTGTTG
Real-time quantitative PCR
FFVgag -F GGACGATCTCAACAAGGTCAACTAAA
FFVgag-R TCCACGAGGAGGTTGCGA
FFVgag-TM AGACCCCCTAGACAACAACAGCAACACT