Skip to main content

Table 1 Primer sequences used for plasmid construction

From: HIV-1 protease with leucine zipper fused at N-terminus exhibits enhanced linker amino acid-dependent activity

Constructs Forward primer (5′–3′)a
DWzPR 5′ CTGTGGATCCTAACTTCCCTCAGGTAACGTTATGGCAA 3′-nt 2273
DWz/PR 5′ CGGGATCCTTCCTTTAACTTCCCTCAGGTCACGTTATGG 3′-nt 2270
DWz//PR 5′ CGGGATCCTACTGTATCCTTTAACTTCCCTCAGGTCACGTTATGG 3′-nt 2270
DWzPRV/P 5′ CGGGATCCTAACGTTCCTCAGATCACGTTATGG 3′-nt 2270
DWz/PRV/P 5′ CGGGATCCTTCCTTTAACGTTCCTCAGATCACGTTATGG 3′-nt 2270
DWz//PRV/P 5′ CGGGATCCTACTGTATCCTTTAACGTTCCTCAGATCACGTTATGG 3′-nt 2270
DWz/PSHL/PR 5′ CGGGATCCTCCCTCTCACCTCCCTCAGGTCACTCTTTGG 3′-nt 2270
DWz/PIDL/PR 5′ CGGGATCCTCCCATTGACCTCCCTCAGGTCACTCTTTGG 3′-nt 2270
DWz/PANF/PR 5′ CGGGATCCTCCCGCTAACTTCCCTCAGGTCACTCTTTGG 3′-nt 2270
p6*PSHL nt 2221-5′ CCGATCGACAAGGAACTGTACCCTCTCACCTCCCTCAG 3′-nt 2258
p6*PIDL nt 2221-5′ CCGATCGACAAGGAACTGTACCCATTGACCTCCCTCAG 3′-nt 2258
p6*PANF nt 2221-5′ CCGATCGACAAGGAACTGTACCCGCTAACTTCC 3′-nt 2254
  1. a The numbers at the 3′ and/or 5′ ends denote HIV-1 proviral DNA nucleotide positions. Nucleotides corresponding to mutated amino acid residues are shown in boldface. Most of the primers contain BamHI sites (underlined) to facilitate cloning