Skip to main content

Table 2 PCR primers

From: Inhibition of human endogenous retrovirus-K by antiretroviral drugs

Target gene Primer sequence (5′–3′)
HERV-K env Forward: CTGAGGCAATTGCAGGAGTT
Reverse: GCTGTCTCTTCGGAGCTGTT
HERV-K gag Forward: AGCAGGTCAGGTGCCTGTAACATT
Reverse: TGGTGCCGTAGGATTAAGTCTCCT
GAPDH Forward: TGCACCACCAACTGCTTAGC
Reverse: GGCATGGACTGTGGTCATGAG
MS2 Forward: TCCTGCTCAACTTCCTGTCGA
Reverse: CACAGGTCAAACCTCCTAGGAATG
Probe: [6FAM]CGAGACGCTACCATGGCTATCGCTGTAG[TAM]