Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers sequence for qPCR

From: ATL-derived exosomes modulate mesenchymal stem cells: potential role in leukemia progression

Primer Sequence Annealing temperature
VEGF F: AGGCCCACAGGGATTTTCTT 55
  R: ATCAAACCTCACCAAGGCCA  
Tax F: CGGATACCCAGTCTACGTGT 62
  R: GAGCCGATAACGCGTCCATCG  
CXCR4 F: CCTCCTGCTGACTATTCCCGA 55
  R: GGAACACAACCACCCACAAGT  
Nanog F: CAGAAGGCCTCAGCACCTAC 58
  R: ATTGTTCCAGGTCTGGTTGC  
MMP-9 F: TTGACAGCGACAAGAAGTGG 55
  R: GCCATTCACGTCGTCCTTAT  
N-Cadherin F: GGTGGAGGAGAAGAAGACCAG 58
  R: GGCATCAGGCTCCACAGT  
α-SMA F: GACAGCTACGTGGGTGACGAA 58
  R: TTTTCCATGTCGTCCCAGTTG  
GAPDH F: TGGTGCTCAGTGTAGCCCAG 58
  R: GGACCTGACCTGCCGTCTAG