Skip to main content

Table 1 Real-time PCR primers

From: TLR8 regulation of LILRA3 in monocytes is abrogated in human immunodeficiency virus infection and correlates to CD4 counts and virus loads

Gene Sequence (5′–3′) Annealing temp. (°C) Length (bp) Source
RPLP0 Fwd TGCTTGATATCACAGAGGAAACTC 60/57 81 (1)
Rev CAATCTGCAGACAGACACTGG
LILRA3 Fwd AGGAGTGGGGACGTGACTT 60 202 (2)
Rev GGTCTGGCACGGATCTGTC
IFNB1 Fwd ATTCTGCATTACCTGAAGGCCA 60 141 (1)
Rev CCAGAGGCACAGGCTAGGA
IFNG Fwd TCGTTTTGGGTTCTCTTGGCT 60 243 (2)
Rev TCTCCACACTCTTTTGGATGCTC
TNF Fwd CTGGAAAGGACACCATGAGCA 60 237 (1)
Rev GGGCCAGAGGGCTGATTAGA
IL1A Fwd AGAGGAAGAAATCATCAAGC 57 122 (3)
Rev TTATACTTTGATTGAGGGCG
IL1B Fwd TCTTTGAAGCTGATGGCCCTAAA 60 188 (1)
Rev GAAGGTCTGTGGGCAGGGAA
IL6 Fwd GCAGAAAAAGGCAAAGAATC 60 178 (3)
Rev CTACATTTGCCGAAGAGC
LILRB1 Fwd TTCTATGACAGAGTCTCCCTCTCGGT 60 99 (4)
Rev AGTTTGCATCCATCCCTGTGACTG
LILRA1 Fwd ATCACAAAACAAGACTGCCTCACA 60 81 (1)
Rev AGGACCAAGCCAGCTATGCC
  1. (1) NCBI Primer Blast; (2) Primer Bank; (3) Sigma Aldrich KiqStart; (4) Primer Quest