Skip to main content

Table 1 DNA oligonucleotides used in this work

From: A functional conserved intronic G run in HIV-1 intron 3 is critical to counteract APOBEC3G-mediated host restriction

Primer Primer sequence
#0640 5′- CAATACTACT TCTTGTGGGT TGG
#1544 5′- CTTGAAAGCG AAAGTAAAGC
#2330 5′- TCTGGATCCA CCACCACCAC CGTAGAT
#2339 5′- TGGGAGCTCT CTGGCTAACT AGGGAACCCACTGCTTAAGC
#3153 5′- CCACTCCTCC ACCTTTGAC
#3154 5′- ACCCTGTTGC TGTAGCCA
#3387 5′- TTGCTCAATG CCACAGCCAT
#3388 5′- TTTGACCACT TGCCACCCAT
#3389 5′- TTCTTCAGAG CAGACCAGAG C
#3390 5′- GCTGCCAAAG AGTGATCTGA
#3391 5′- TCTATCAAAG CAACCCACCTC
#3392 5′- CGTCCCAGAT AAGTGCTAAGG
#3395 5′- GGCGACTGGG ACAGCA
#3396 5′- CCTGTCTACT TGCCACAC
#3397 5′- CGGCGACTGA ATCTGCTAT
#3398 5′- CCTAACACTA GGCAAAGGTG
#3631 5′- CGGCGACTGA ATTGGGTGT
#3632 5′- TGGATGCTTC CAGGGCTC
#3633 5′- CGACACCCAA TTCTTGTTAT GTC
#3636 5′- CCGCTTCTTC CTTGTTATGT C
#3896 5′- TTCACTCTTA AGTTCCTCTA AAAGCTCTAG TGTCCATTCA TTGTATGGCT CTCTCTGTGG CCCTTGGTCT TCTG
#3897 5′- GTTGCAGAAT TCTTATTATG GCTTCCACTC CTGCCCAAGT ATCGCCGTAA GTTTCATAGA TATGTTGTCC TAAGTTATG
#4324 5′- TAATACGACT CACTATAGG
#4355 5′- TTCATCGAAT TCAGTGCCAA GAAGAAAAGC AAAGATCA
#4614 5′- TTCATTGTAT GGCTCCCTCT GTGGCCCTTG ACATGGGTGA TCCTCATGTC CTATAGTGAG TCGTATTA
#4615 5′- TTCATTGTAT GGCTCTCTCT GTGGCCCTTG ACATGGGTGA TCCTCATGTC CTATAGTGAG TCGTATTA
#4718 5′- TAGTGTCCAT TCATTGTATG GCTCCCTCTG TGGCCCCTGG T
#4720 5′- TAGTGTCCAT TCATTGTATG GCTCTCTCTG TGGCCCCTGG T
#4843 5′- CCGCTTCTTC CTTTCCAGAG G
#4849 5′- CCTCTGGAAA GAATTGGGT
vifmut-forward 5′- AGGGCCACAG AGAGAGCCAT ACAATG
vifmut-reverse 5′- CATTGTATGG CTCTCTCTGT GGCCCT