Skip to main content

Advertisement

Table 1 Primer sequences

From: Bone marrow stromal cell antigen 2 (BST-2) restricts mouse mammary tumor virus (MMTV) replication in vivo

Primer name Forward sequence Reverse sequence
mBST-2 TCAGGAGTCCCTGGAGAAGA ATGGAGCTGCCAGAGTTCAC
MMTV CGTGAAAGACTCGCCAGAGCTA TAATGTTCTATTAGTCCAGCCACTGT [32, 33]a
GAPDH CCCCTTCATTGACCTCAACTACA CGCTCCTGGAGGATGGTGAT [32, 33]a
Puromycin CGTACGCACCCTCGCCGC TCGTCCGCGACCCACACC
IFNα GCTAGGCTCTGTGCTTTCCTGATG CTCAGGTACACAGTGATCCTGTGG
IFNβ AACAGGTGGATCCTCCACGCTGCG GTGGAGAGCAGTTGAGGACATCTCC
2'-5'-OAS CTTTGATGTCCTGGGTCATGT CTCCGTGAAGCAGGTAGAG
  1. Sequence of primer pairs used in this study. Citation means the primer has been previously reported.