Skip to main content

Advertisement

Table 2 Primers used in PCR amplification and sequencing of GNB3 C825T SNP

From: The role of G protein gene GNB3 C825TPolymorphism in HIV-1 acquisition, progression and immune activation

Primer Set Forward Primer (5' - 3') Reverse Primer (5'-3') Ta (°C)
Outer GCTGCCCAGGTCTGATCCCT CCAGTGACAAGGGACAGCAGTAAG 60
Inner TGACCCACTTGCCACCCGTGC GCAGCAGCCAGGGCTGGC 60
Sequencing CAGTTCTTCCCCAATGGAGAGG GGCTGGCCCTTACCCACACG 55
  1. Ta: annealing temperature.