Skip to main content

Table 2 Primers and probes for real-time PCR

From: SIV antigen immunization induces transient antigen-specific T cell responses and selectively activates viral replication in draining lymph nodes in retroviral suppressed rhesus macaques

SIV doubly spliced Forward: 5'- AGGCTAATACATCTTCTGCATCAAAC - 3'
  Reverse: 5'- GGGTCCTGTTGGGTATGAGTCTA - 3'
  Probe: 5' - CCACCCTCTTATTTCC - 3'
SIV singly spliced Forward: 5'- AGAGGCCTCCGGTTGCA-3'
  Reverse: 5'- CCTTCCCCTTTCCACAATAGC-3'
  Probe: 5'-ACTGTGGAAGGGACC-3'
SIV unspliced Forward: 5'- TTGCAGCACCCACAACCA-3'
  Reverse: 5'-TGATCCTGACGGCTCCCTAA-3'
  Probe: 5'- CTCCACAACAAGGACA-3'
IFN-γ Forward: 5'- GTGTGGAGACCATCAAGGAAGAC-3'
  Reverse: 5'- CGACAGTTCAGCCATCACTTGGAT-3'
  Probe: 5'-ACTGACTCGAATGTCCAACGCAAAGC-3'
GAPDH Forward: 5'-GGCATCCTGGGCTACACTGA-3'
  Reverse: 5'-AGGAGTGGGTGTCGCTGTTG-3'
  Probe: 5'- AGGTGGTCTCCTCTGAC -3'