Skip to main content

Table 2 PCR oligos and conditions

From: Serologic and PCR testing of persons with chronic fatigue syndrome in the United States shows no association with xenotropic or polytropic murine leukemia virus-related viruses

Oligo Name Sequence (5'→3') Location1 Sample Conditions
pol Forward GGGGATCAAGCCCCACATA 2794 to 3062 2.5 μg DNA 95°C for 20 s followed by 45 cycles of 95°C for 1 s and 60°C for 20 s [14]
   Reverse GGTGGAGTCTCAGGCAGAAAA    
   Probe [6FAM] TGTTCCAGGGGGACT GGCAAGGTACCAccctgg [DABC]2,3    
pol2 XPOLOF CCGTGCCCAACCCTTACAACCTCT 2961 to 3330 1.0 μg DNA 40 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 45 s for both primary and nested PCR [9]
   XPOLOR CCGAGGTTCCCTAGGGTTTGTAAT    
   XPOLIF TCCACCCCACCAGTCAGCCTCTCT    
   XPOLIR AAGTGGCGGCCAGCAGTAAGTCAT    
   XPOLP TTGATGAGGCACTGCACAGAGACC Probe   
gag1 GagOF ATCAGTTAACCTACCCGAGTCGGAC 419 to 1149 0.25 μg DNA; RNA from 62 μL plasma 40 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 45 s for both primary and nested DNA PCR [5, 9]. RT-PCR; Primer 1154R was used for cDNA synthesis at 42°C for 1 hr with the IScript Select cDNA kit (BioRad) followed by 85°C, 5 min to stop the reaction. Nested PCR was then performed as for DNA testing using the Expand High Fidelity PCR System (Roche) and AmpliTaq (Applied Biosystems) for the primary and nested PCRs.
   GagOR GCCGCCTCTTCTTCATTGTTCTC    
   GagIF GGGGACGAGAGACAGAGACA    
   GagOR CAGAGGAGGAAGGTTGTGCT    
   XGagP2 ACCTTGCAGCACTGGGGAGATGTC Probe   
gag2 Forward AGGTAGGAACCACCTAGTYC 1581 to 1764 RNA from 62 μL plasma RT-PCR using AgPath-ID one step RT-PCR kit (Applied Biosystems) and BioRad iQ5 iCycler. Reverse primer used for cDNA synthesis at 45°C for 20 min; 95°C for 10 min. 55 cycles at 95°C, 30 s, 52°C, 30 s, 62°C, 30 s.
   Reverse GTCCTCAGGGTCATAAGGAG    
   Probe F [6FAM]AGCGGGTCTCCAAAACGCGGGC[BHQ1]3 1620   
   Probe R [6FAM]CCTTTTACCTTGGCCAAATTGGTGGGG[BHQ1]3 1673   
  1. 1Reference sequence was the VP62 XMRV strain (GenBank: EF185282.1).
  2. 2Lower case bases were added to form the stem.
  3. 3[6FAM] and [DABC] and [BHQ1] are the fluorophore FAM and the quenchers Dabcyl and Blackhole, respectively.