Skip to main content

Table 1 List of the genes and primer pairs used for qPCR and qRT-PCR experiments

From: Proviral integrations and expression of endogenous Avian leucosis virus during long term selection for high and low body weight in two chicken lines

Primer names forward/revers Amplicon in figure 1A Forward Reverse
Beta-actinF/Beta-actinR - AGGTCATCACCATTGGCAATG CCCAAGAAAGATGGCTGGAA
GAPDHF/GAPDHR - GGGAAGCTTACTGGAATGGCT GGCAGGTCAGGTCAACAACA
POMCF/POMCR - GCTACGGCGGCTTCATGA CGATGGCGTTTTTGAACAGAG
PMCHF/PMCHR - CGAAATGGAGACGGAACTGAA CATCCAAGAAGCTTTCCTCAATCT
Val_envF/Val_envR b* ACCCGGACATCACCCAAAG AGTCAGAAATGCCTGCAAAAAGA
chENV232fwd/chENV1046rev e* ACGGATTTCTGCCTCTCTACACA TTCCTTGCCATGCGCGATCCC
qPCR_envF/qPCR_envR d* GAAACTACCTTGTGTGCTGTCG CGGATGTTGTGGAAAAACGA
env277F/env353R c* CCCAAAATCTGTAGCCATATGC TACGGTGGTGACAGCGGATAGG
pol197F/pol269R a* TGCTTGTCTCCCCAGGGTAT GGTGACTAAGAAAGATGAGGCGA