Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Primers and probes used to quantify viral sequences by real-time PCR

From: Modulation of HIV-1 infectivity and cyclophilin A-dependence by Gag sequence and target cell type

GAPDH  
forward primer 5'- ACCCCTGGCCAAGGTCATC
reverse primer 5'- AGGGGCCATCCACAGTCTTC
Probe 5'- (6-Fam)AGGACTCATGACCACAGTCCATGCCA(Tamra)
CypA  
forward primer 5'- GGCCGCGTCTCCTTTGA
reverse primer 5'- AATCCTTTCTCTCCAGTGCTCAGA
Probe 5'- (6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG(Tamra)
TRIM5α  
forward primer 5'- TGCCTCTGACACTGACTAAGAAGATG
reverse primer 5'- GGGCTAAGGACTCATTCATTGG
Probe 5'- (6-Fam)AAGCTTTTCAACAGCCTTTCTATATCATCGTGTGATA(Tamra)