Skip to main content

Table 2 Primer sequences and PCR conditions

From: Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells

Target Primer Sequences (5'-3') PCR conditions
Integrated HIV-1    
DNA a    
• First round PCR L-M667 ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTG 95°C, 8 min and 95°C, 10 s, 60°C, 10 s, 72°C, 170 s for 12 cycles
  Alu 1 TCCCAGCTACTGGGGAGGCTGAGG  
  Alu 2 GCCTCCCAAAGTGCTGGGATTACAG  
• Second round PCR Lambda T ATGCCACGTAAGCGAAACT 95°C, 8 min and 95°C, 10 s, 60°C, 10 s, 72°C, 9 s for 40 cycles
  AA55M GCTAGAGATTTTCCACACTGACTAA  
Linear HIV DNA a MH531 TGTGTGCCCGTCTGTTGTGT 95°C, 8 min and 95°C, 10 s, 60°C, 10 s, 72°C, 6 s for 40 cycles
  MH532 GAGTCCTGCGTCGAGAGAGC  
2-LTR circle a HIV F GTGCCCGTCTGTTGTGTGTGACT 95°C, 8 min and 95°C, 10 s, 60°C, 10 s, 72°C, 10 s for 40 cycles
  HIV R ACTGGTACTAGCTTGTAGCACCATCCA  
U5-U3 RNA a HIV F GTGCCCGTCTGTTGTGTGTGACT 95°C, 2 min and 95°C, 5 s, 60°C, 10 s, 72°C, 10 s for 40 cycles
  HIV R ACTGGTACTAGCTTGTAGCACCATCCA  
Gag For CCCATAGTGCAGAACATCCA 50°C, 2 min, 95°C, 2 min, and 95°C, 15s and 60°C, 30s, for 50 cycles
  Rev GGGCTGAAAGCCTTCTCTTC  
Singly spliced b M669 GTGTGCCCGTCTGTTGTGTGACTCTGGTAAC 50°C, 2 min, 95°C, 2 min, and 95°C, 15s and 60°C, 30s, for 50 cycles
  La 23 GCCTATTCTGCTATGTCGACACC  
Multiply spliced HIV RNA a P659 GACTCATCAAGTTTCTCTATCAAA 95°C, 4 min and 95°C, 5 s, 54°C, 10 s, 72°C, 8 s for 40 cycles
  P413MOD AGTCTCTCAAGCGGTGGT  
Unspliced HIV RNA a La 9 GACGCTCTCGCACCCATCTC 95°C, 2 min and 95°C, 10 s, 60°C, 40 s for 40 cycles
  La 8.1 CTGAAGCGCGCACGGCAA  
β-actin Actin F ATGGCCACGGCTGCTTCCAGC 95°C, 15 s, 55°C, 30 s, 72°C, 15 s for 30 cycles
  Actin R CATGGTGGTGCCGCCAGACAG  
GAPDH GAPDH F GAGTCAACGGATTTGGTCGT 95°C, 15 s, 60°C, 30 s, 72°C, 15 s for 30 cycles
  GAPDH R TTGATTTTGGAGGGATCTCG  
  1. a Primer sequences and PCR conditions were modified from [40]
  2. b Primer sequences and PCR conditions were modified from [74]
\