Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used to create the D51N, D51E and D51Q CAp24 mutants

From: Characterization of the invariable residue 51 mutations of human immunodeficiency virus type 1 capsid protein on in vitro CA assembly and infectivity

  5' primer 3' primer
D51E GCCACCCCACAAGAGTTAAATACCATG CATGGTATTTAACTCTTGTGGGGTGGC
D51Q GCCACCCCACAACAATTAAATACCATG CATGGTATTTAATTGTTGTGGGGTGGC
D51N GCCACCCCACAAAATTTAAATACCATG CATGGTATTTAAATTTTGTGGGGTGGC