Skip to main content

Table 1 Oligonucleotides used throughout these experiments

From: The strength of the HIV-1 3' splice sites affects Rev function

Oligo no. sequence
#139 5'-CCCAAGCTTTCTAGACTCGAGCTACAAAATCCTTTC
#377 5'-CTGAAGCGCGCACGGCAAGAGGCGAGGGGAGGCGACTG
#480 5'-GCGCGCTTCAGCAAGC
#481 5'-GCGCGCACGGCAAGA
#559 5'-CTTTACGATGCCATTGGGA
#626 5'-TGTCTTAAGTATAGTGAATCGCGTTCGCCAAGGATACTCACCA
#628 5'-CCCCTCGGGATTGGGAGGTGGGTTTGGAAGCTTAGTGGTGAGTATCC
#796 5'-TGAGGTTACCGTTCTTTCTATT
#797 5'-GATCCCGGGATCCTCGGGATTGGGAGGTGGGTCTGAAAAGAAAGAGGAGAATAACCTTGACGAACACGGTTAGCAATAGAAAGAAC
#798 5'-TGAACTAGTAGGTTTAAGAATAGTTTTTGCTGTTCTTTCTATT
#800 5'-TGAGGTTACCGTACTTTCTATAGTGAAT
#918 5'-GCTATGTCGACAAGGAGCTGCAGATCGATGAATTCGATACTTACCAGTCGCCTCCCCTC
#931 5'-GCTATGTCGACACCCAATTCTGAAACGATAATGGTGAATATCCCTGCCTAACTCTATTCACTATA
#932 5'-ATCCTGCAGAATAGTTTTTGCTGTACTTTCTATAGTGA
#936 5'-ACTGGTTACCACATATCTATGAAACT
#939 5'-ACAGGATCCATCCCCGGGCTGAAATGGATAAACA
#940 5'-ACTGGTTACCTGTACCAATTGCTATT
#941 5'-ACAGGATCCATCCCCGGGCTAAGGCTTTTGTCAT
#942 5'-ACTGGTTACCAAAAAGTGTTGCTTTC
#943 5'-ACAGGATCCATCCCCGGGCTGCCATAGGAGATGC
#945 5'-ACAGGATCCATCCCCGGGCTGAAAAACAGTCAAA
#946 5'-ACTGGTTACCACCCTGAATTAGCAGA
#947 5'-ACAGGATCCATCCCCGGGCTGTAATAAACCCGAA
#948 5'-ACTGGTTACCTAGCAACAGACATACA
#985 5'-GATGGATCCCGGGCTCGGGATTGGGAG
#986 5'-TGAGGTTACCGTCTTAAGTATA
#1065 5'-ATCCCCGGGCTGAAACGATAATGGTGA
#1088 5'-ACAGGATCCATCCCCGGGTGCTTTGATAGAGAAG
#1089 5'-ACAGGATCCATCCCCGGGCTTTCCAGAGGAGCTT
#1091 5'-ACAGGATCCATCCCCGGGCTTGTTATGTCCTGCT
#1183 5'-CTAGAATTCAGCAACAGACATACA
#1224 5'-TCTTCCAGCCTCCCATCAGCGTTTGG
#1225 5'-CAACAGAAATCCAACCTAGAGCTGCT
#1388 5'-TGAGGTTACCAAAAAGTGTTGCTTTCATTGCCACGTTTGTTTCATGAC
#1389 5'-ATCCCCGGGCTGAAAGAGGAGAAGGCGAGGGCGTTTGTCATGAAAC
#1481 5'-ATCCCCGGGCTGAAAGAGGAGAAGGCTAGGGCTTTTGTCATGAAAC
#1482 5'-TGAGGTTACCAAAAAGTGTGGCGTCCGTTGCCACGTTTGTTTCATGAC
#1483 5'-ATCCCCGGGCTGCCATAGGAGATGCCGAAGGCGTTTGTCATGAAAC
#1484 5'-ATCCCCGGGCTGCCATAGGAGATGCCGAAGGCGTTTGTTAGTAAAC
#1486 5'-ATCCCCGGGCTGAAATAGGAGATGCCTAAGGCTTTTGTCATGAAAC
#1492 5'-ACAGGATCCATCCCCGGGAGGGCTCTAGTCTAGG
#1542 5'-CACCTTCTTCTTCTATTCCTT
#1544 5'-CTTGAAAGCGAAAGTAAAGC
#1586 5'-TGAGGTTACCAAAAAGTGTGGCGTCCGTTGCCACGTTTGTTTACTAAC
#1587 5'-ATCCCCGGGCTGAAAGAGGAGAAGGCGAGGGCGTTTGTTAGTAAAC
#1590 5'-ATCCCCGGGCTGAAAGAGGAGAAGGCGAGGGCGTTTGTCATGAAAC
#1591 5'-TGAGGTTACCAAAAAGTGTTGCTTTCATTGCCACGTTTGTTTCATGAC
#1592 5'-ATCCCCGGGCTGAAATAGGAGATGCCGAAGGCGTTTGTTAGTAAAC
#1913 5'-TACTGCAGTACTTTTATGTCACTATTATCTTGTATTACTACTGCCCCTTCACCTTTCCAGAGGAGCTTTGCTG
#1913a 5'-CTACTGCAGTACTTTTATGTCACTATTATCTTGTATTACTACTGCCCCTTCACCTTTCCAGAGGAGCTTTGCTGGTCGATAGCAAACTGGATCTCTG
#1913b 5'-CTACTGCAGTACTTTTATGTCACTATTATCTTGTATTACTACTGCCCCTTCACGATAGCAGAGGAGCTTTGCTG
#2183 5'-GGTCAGGGTCTACTTGTGTGC
#2335 5'-GGGTCTCTCTGGTTAGACCAG