Skip to main content

Table 1 Primers used to amplify regions of NF90ctv by PCR for cloning into the pCI-neo vector.

From: Nuclear Factor 90, a cellular dsRNA binding protein inhibits the HIV Rev-export function

  Amplified region Construct
5'-primer: 5'GGGGGGGAATTCGCTAGCCGCCACCAATGCAGAAGACGGAGCACATGAC3'
3'-primer: 5'GGGGGGCCCGGGGCGGCCGACTAGATGGTCAGGGACAATGGACGCTCTTT3'
NES pCI-neo/NES NF90
5'-primer: 5'GGGGGGGAATTCGCTAGCCGCCACCAATGAATGCCCTGATGCGGTTGAA3'
3'-primer: 5'GGGGGGCCCGGGGCGGCCGACTAAGCACCCGTCGGCAAGCCCATGTCCTG3'
DRBD 1 pCI-neo/DRBD 1 NF90
5'-primer: 5'GGGGGGGAATTCGCTAGCCGCCACCAATGAAGAACCCAGTCATGGAGCTG3'
3-primer: 5'GGGGGGCCCGGGGCGGCCGACTAAGGGAAAAGTTTTTCTAGGGCAGCAAG3'
DRBD 2 pCI-neo/DRBD 2 NF90
5'-primer: 5'GGGGGGGTCGACCGCCACCAATGAAGCTTTTCCCTGACACCCCTCTCGCC3'
3'-primer: 5'GGGGGGCCCGGGCGGCCGCCTATGTAGCCTCCATGGTTGGCGCCACCAAA3'
RG- pCI-neo/RG- NF90