Table 2 Sequences and genomic positions of mapped HERV-W gag (A) and env (B) elements. Dashes indicate nucleotides that are identical with the prototypical HERV-W sequences. Open circles indicate gaps in sequence. Sequences that could not be unambiguously mapped to one genomic loci are indicated by the number of indistinguishable genomic loci found.
From: Transactivation of elements in the human endogenous retrovirus W family by viral infection
A | |||
|---|---|---|---|
5' LTR | 5' HERV-W gag3' | Tm(°C) | Genomic location (strand) |
Truncated | GAGGAAooAGAACAACTCCCooACAGGCCAGCAGGC | 80.2 ± 0.2 | 3q26:180256375-180256406(+) |
None | -- A---AG-------T----C--------------- | 80.2 ± 0.2 | 5p13:31432195-31432224(-) |
Truncated | ---------------T----C--o------------ | 80.9 ± 0.2 | 12p13:8809216-8809247(-) |
None | ------AG-------T----C------------A-- | 79.7 ± 0.2 | 12p12:18113623-18113657(+) |
Complete | ------AG-------T----CC-------------- | 80.2 ± 0.2 | 1q42:224124801-224124836(-) |
n/a | --------------------C--------------- | 80.2 ± 0.2 | 2 elements |
n/a | ------AG-------T----C--------------- | 80.2 ± 0.2 | 15 elements |
n/a | ------AG-----G-T----C--------------- | 80.2 ± 0.2 | 11 elements |
n/a | ---------------T----C--------------- | 79.7 ± 0.2 | 4 elements |
B | |||
5' LTR | 5' HERV-W env 3' | Tm(°C) | Genomic location (strand) |
n/a | TCCTCCCACACAAATAGTCTGCCTACCCTC | 77.6 ± 0.2 | 5 elements |
Truncated | ---C---o---G------------------ | 78.1 ± 0.2 | 15q21:53385581-53385607(-) |
None | A----------G------------------ | 78.7 ± 0.2 | Xq22:106102713-106102742(-) |
n/a | -----------G------------------ | 77.6 ± 0.2 | 5 elements |