Skip to main content

Advertisement

Table 3 Primers used for PCR

From: Involvement of HTLV-I Tax and CREB in aneuploidy: a bioinformatics approach

Accession # Gene ID Forward Reverse Size(bp) Correctly mapped
D87898 Arf1 ACCCTTGCTCGTTCTAGTGC GGTTTCGCTCCCACAAGAT 224 Yes
AF016583 Chek1 CCACCACACTTGCTTTCCTT GGAATCCAAATGCACAGCTT 583 Yes
AF098508 Dctn3 TTTGGGTGTACGTCCTGACA CAGCTCCTCCACTCGAGACT 486 Yes
NM_009503 p97(Vcp) ATTGCCTTTGTCGATTGGTC TCGGAAGGAAAGCTGCTCTA 228 Yes
BC046832 Ppp1cb AGCAGGGAAGGAAGGTCATT GGCGTTCTCACCTACGAGTC 529 Yes
AJ534939 Smc2l1 CTTACAGCCGTTTGCCTAGC CCGTTTTGAACATGGAAAGC 439 Yes
BC009167 Sgt1 AGCCGACTTAGGAAGGAAGC GTCTCGGAGCCCACTGTAAG 325 Yes
AF077002 Ywhah AGGTCCCCGTAGGTATGTCC CCCAGCCCTAACGGTCTT 507 Yes