Skip to main content

Table 2 Analysis of U5-PBS from viruses following extended in vitro culture in PBMC

From: Preferences for the selection of unique tRNA primers revealed from analysis of HIV-1 replication in peripheral blood mononuclear cells

Virus U5-PBS   Days Post-Culture
  Ile3   
NL4-3-Ile-AC 15' AGTCAGTGTTTATCAGCTCTAGCAG 2TGGTGGCCCGTACGGGGA TTGAAA 3' Input5 0
  Ile   
  45' ************************* ****************** ****** 3' PCR Product6 21
  Lys, 3   
  5' ************************* TGGCGCCCGAACAGGGAC -***** 3' 6/7 TA Clones7 35
  Lys,1,2   
  5' ************************* TGGCGCCCAACGTGGGGC -***** 3' 1/7 TA Clones 35
  Lys, 3   
  5' ************************* TGGCGCCCGAACAGGGAC -***** 3' PCR Product 73
  Met   
NL4-3-Met-AC 5 5' AGTCAGTGTTGTGAGACTGTAGCAG TGGTGCCCCGTGTGAGGC GAAAGC 3' Input 0
  Met   
  5' ************************* ****************** ****** 3' 5/10 TA Clones 35
  5' ************************* *****************A ****** 3' 3/10 TA Clones 35
  5' ********************* *A* * ****************** ****** 3' 1/10 TA Clones 35
  5' ************************* *******T********** ****** 3' 1/10 TA Clones 35
  Met   
  5' ************************* ****************** A***** 3' 6/9 TA Clones 63
  5' ************************* *****************A A***** 3' 2/9 TA CIones 63
  5' *********C*****G********* ****************** A***** 3' 1/9 TA CIones 63
  1. 1. The U5-loop is in bold type.
  2. 2. Spaces separate the PBS (indicated in bold type) from flanking sequence.
  3. 3. PBS complementary to the 3' terminal 18-nucleotide sequence of the indicated host tRNA.
  4. 4. Asterisks represent conserved nucleotides.
  5. 5. "Input" refers to the clone that was used to initiate viral infection in PBMCs.
  6. 6. PCR product that was sequenced directly.
  7. 7. Refers to TA clones of PCR product that is cloned into the Promega, P-Gem T-Easy Vector System I, to isolate individual colonies for sequencing.