Figure 1

A) Hydrophobicity profile and predicted features of the EnvV (formerly W/FRD-like env) and EnvP(b) (formerly ZFERV-like env) proteins. The SU (Surface Unit) and TM (TransMembrane) moieties of the envelopes are delineated, with the position of the putative proteolytic cleavage site (consensus, R/K-X-R/K-R) between the two subunits and the « CWLC » motif (consensus, C-X-X-C) indicated. The hydrophobic regions associated with the fusion peptide and the transmembrane region are shaded in light gray, and the putative immunosuppressive domain (ISU) in dark gray. B) Phylogenetic tree of retroviral envelopes and position of the newly identified genes. The tree is based on an alignment of approximately 180 amino acids corresponding to the extracellular and transmembrane domains of the TM subunit of envelope proteins. The protein alignment, phylogenetic tree and bootstrap analysis were performed with the ClustalW program (neighbour joining option). The tree was viewed by using the TreeView program. The scale bar indicates 10% aa sequence difference. The phylogenetic tree determined by the parsimony method was congruent with the neighbour joining tree (data not shown). The two "new" V and P(b) env genes are represented in red, ERV env genes from other species and exogenous retroviruses in blue. The sequences used for the alignments were those of the consensus element of each family, or the coding env gene when present. The consensus sequences of the HERVK(HML-9), HERVFXA21B1 and HERVFXA21B2 families, which are not listed in Repbase, were each inferred from the comparison of 3–6 sequences. Abbreviations: MoMLV, Moloney Murine Leukemia Virus; FeLVA, Feline Leukemia Virus strain A; PERVC, Pig Endogenous Retrovirus strain C; GALV, Gibbon Ape Leukemia Virus; MPMV, Mazon-Pfizer Monkey Virus; MMTV, Mouse Mammary Tumor Virus; JSRV, Jaaksiekte Sheep Retrovirus; HTLV, Human T cell leukemia Virus; BLV, Bovine Leukemia Virus; HIV, Human Immunodeficiency Virus. C) Genomic organization of the envV and envP(b) loci. The envelope ORF (open box) with gag- and pol- related sequences (hatched boxes) and long terminal repeats (black boxes), Alu (dark gray boxes) and MER51B (light gray boxes) retroelements are indicated. Consensus PBS sequences (obtained from two sequences for the HERV-V family and from four sequences for the HERV-P(b) family) are indicated above the corresponding provirus, together with the PBS for the Val and Pro-tRNA, respectively. D) envV and envP(b) mRNA expression in a panel of 19 healthy human tissues, as determined by real-time quantitative RT-PCR. RNAs from human tissues were prepared as described in [6]. The reaction was performed using Sybr Green Master Mix (Applied Biosystems). PCR was developed using an ABI PRISM 7000 sequence detection system. Primer sequences (5'-3') were as follows: (CATGACTTTGGAAAAGGAGG) and (GCCAAAGAGGAAAAGTAAGAGT) for envV; (CAAGATTGGGTCCCCTCAC) and (CCTATGGGGTCTTTCCCTC) for envP(b). The transcript levels were normalized relative to the amount of 18S mRNA (as determined with the primers and TaqMan probe from Applied Biosystems). Samples were assayed in duplicate. PBL, peripheral blood lymphocytes. E) Assay for fusogenicity of envV and envP(b). XhoI containing primer sequences (5'-3') were as follows: (ATCACCTCGAGACACTCCATCGAACCACTTCAT) and (ATCACCTCGAGGGCTGTTCTAGGATGGGTTATT) for envV; (ATCACCTCGAGAGAAGAGAAACTTGAACCGTCC) and (ATCACCTCGAGGGGCTGATAGATGAATGGGTAT) for envP(b). The PCR products were cloned into the phCMV-G vector, opened with XhoI, and the constructs were verified by partial sequencing. Cell lines and fusion assays are as described in [12], except for the SH-SY5Y neuroblastoma cell line (ATCC number CRL-2266).