Skip to main content

Advertisement

Table 1 The sequences of TAR and R oligonucleotides used in this study

From: Similarities and differences in the nucleic acid chaperone activity of HIV-2 and HIV-1 nucleocapsid proteins in vitro

Name Sequence 5′ ‒ 3′‒ Length
TAR1(+) DNA GGTCTCTCTTGTTAGACCAGGTCGAGCCCGGGAGCTCTCTGGCTAGCAAGGAACCC 56
TAR1(−) DNA GGGTTCCTTGCTAGCCAGAGAGCTCCCGGGCTCGACCTGGTCTAACAAGAGAGACC 56
TAR1(−)mut DNA GGGTTCCTTGCTAGCCAGAGAGCTCCCGGGCTCGACCTGGTCTTTGAACTCAGAGG 56
TAR1 RNA GGUCUCUCUUGUUAGACCAGGUCGAGCCCGGGAGCUCUCUGGCUAGCAAGGAACCC 56
R1(+) DNA GGTCTCTCTTGTTAGACCAGGTCGAGCCCGGGAGCTCTCTGGCTAGCAAGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCCTCCC 96
R1(−) DNA GGGAGGCACTCAAGGCAAGCTTTATTGAGGCTTAAGCAGTGGGTTCCTTGCTAGCCAGAGAGCTCCCGGGCTCGACCTGGTCTAACAAGAGAGACC 96
R1(−)mut DNA GGGAGGCACTCAAGGCAAGCTTTATTGAGGCTTAAGCAGTGGGTTCCTTGCTAGCCAGAGAGCTCCCGGGCTCGACCTGGTCTAACATCAGTCTCTA 97
TAR2 RNA GGTCGCTCTGCGGAGAGGCTGGCAGATTGAGCCCTGGGAGGTTCTCTCCAGCACTAGCAGGTAGAGCCTGGGTGTTCCCTGCTAGACTCTCACCAGCACTTGGCCGGTGCTGGGCAGACGGCC 123
TAR2(−) DNA GCCGTCTGCCCAGCACCGGCCAAGTGCTGGTGAGAGTCTAGCAGGGAACACCCAGGCTCTACCTGCTAGTGCTGGAGAGAACCTCCCAGGGCTCAATCTGCCAGCCTCTCCGCAGAGCGAC 121