Skip to main content

Table 1 Codon optimized Vpx and Vpr sequences

From: Vpx rescue of HIV-1 from the antiviral state in mature dendritic cells is independent of the intracellular deoxynucleotide concentration

Accessory gene Codon-optimized nucleic acid sequence
SIV MAC-251 Vpx atgagcgacccaagagaaagaatcccacctggaaatagcggcgaagaaactattggagaggctttcgagtggctgaatagaaccgtggaggagataaatagagaagctgtgaaccatctgcccagagagctgatcttccaagtgtggcaaaggagctgggagtattggcacgacgagcagggcatgtcccagagctatgtgaaatatagatatctgtgtctgatgcagaaggcactgttcatgcactgtaaaaagggctgtaggtgcctcggggaaggacatggggccggcggatggaggcccggcccacctcctccccctccccccggcctcgcatga
HIV-2 ROD Vpx atgacagatccacgagagaccgtacccccaggcaacagtggagaagaaaccattggcgaggcgttcgcatggctcaacaggacggtggaggccatcaacagagaagccgtaaatcacctgcccagggaacttatctttcaggtctggcagaggagctggcggtactggcacgacgagcagggcatgtctgagagctataccaaataccgctacctttgtatcatccagaaggccgtttacatgcacgtgagaaaaggatgtacatgcttgggaagaggtcacggccctggcggctggagacctggcccaccaccccctcccccacctgggctggtgtga
SIV RCM Vpx atggctgagcgggcaccagaagtgccaactggcgccggcgaggccgagtttcagccctggctccgggacatgttggagaaagtcaacctggaggcccggttgcacttccaccccgaattcatctttaggctgtggagaacatgcgtcgagcactggcatgatgtgcaccagaggtccctggagtacgccgcctataggtacctcctcctgatgcagaaggccctgttcattcactgccagaccgggtgtagccaaagacatgggcccaatcctagggctgtgggagagcgcattacaatcctgcctgggatgtga
SIV MUS1CM1239 Vpr atggagagggtgcccccatcacatcggcccccatggcactccagggtggtcccaactaccatgcagcaggcacagcaggctatgtgggacctgaacgaggaagccgagaagcacttcagcagagaggagctgcggggaatctggaacgatgtcaccgagctccccgccgatcccaactggaccgtggatcaggccgctattgcctgtgccattgattacattcggcggactcagacactcctgtttcggcactacagggaaggctgctatcaccggtacagcaacacaatccgcaggtaccctaacatcagacccttgcgcgggacacaagcccctcccagtaacagcatgccaaatgccgaccctacacctccccttagaccctctaggtacaggatggacgagtga
SIV DEBCM5 Vpr atggagcgctatcctcctagtcatcccccacatttcacatccagaactgtcccaatgacccggctggcactgcagcaggccatgcaggacctgaacgaggaggccctgaagcacttcaccagggaagagttgtggggggtgtggaaccactgtgtcgatttgcccgcccagcccgattggacaggagagcaggcctgggccgctagcgtgatcgattacattaaaatcgtgcaaaggatgctctggctccaccttagggaggcttgctttcaccgggagagagaggccacacggcggtaccccaacattaggccactgaccggccggaatagggaggtgagagacggggaatga